Editing 493-pLVXPlus2-App-IRES-mCherry

Cloning of 493-pLVXPlus2-App-IRES-mCherry 

Purpose: to subclone from 303 pLentiGP-App to pLVXPlus2-IRES-mCherry, 174<br> 

Date: 2011-11-10---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:456+493 clone11-8-2011.JPG]]<br> 

method1: 

digest 303 with BamH1 + Nhe1--&gt; insert(band3), ligate to BamH1 + PmeI digested pLVXPlus2-IRES-mCherry, 174(band4). 

purify with OMEGA column then add pfu polymerase + dNTP to fill in (37C,1hour), ligate again. 

transform STBL3.<br> 

[[Image:237+469+493 digest detect 11-14-2011.JPG]] 

digest detect: BamH1+Xho1 

<br> 

Date: 2011-11-15---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:493 subclone 11-15-2011.JPG]]<br> 

[[Image:493 subclone11-15-2011.JPG]]<br> 

method1: 

digest 303 with BamH1 + Nhe1--&gt; insert(band3), ligate to BamH1 + PmeI digested pLVXPlus2-IRES-mCherry, 174(band4). 

purify with OMEGA column then add pfu polymerase + dNTP to fill in (37C,1hour), ligate again. 

transform STBL3. 

<br> 

Date: 2011-11-23---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:493 PCR 11-23-2011.JPG]]<br> 

method2: 

PCR template is pCMV-SPORT6-App 305 

using these primers<br>App-BamH1-F<br>atcga ggatcc gcc acc atgctgcccagcctggcactg 

App-HindIII-Sfi1-R<br>(gttctt tgagcagatg cagaactaa AAGCTT GGCCAAACAGGC atcgact)<br>agtcgatGCCTGTTTGGCCAAGCTTttagttctgcatctgctcaaagaac 

band 1,2,3 use high GC buffer&nbsp; because of the GC content,<br>band 4,5,6 use HIFi buffer <br> 

[[Image:493 clone insert+vector11-23-2011.JPG]]<br> 

Digest PCR product with BamH1 + Sfi1, digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 + Sfi1<br> 

<br> 

Date: 2011-11-28---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:493 insert+vector11-28-2011.JPG]]<br> 

Digest PCR product (band 2) with BamH1 + Sfi1, digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 + Sfi1(band 3)<br> 

[[Image:461+493 digest detect 12-1-2011.JPG]]<br> 

digest detect:BamH1 + Sfi1<br> 

<br> 

Date: 2011-12-2---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:493 clone 1st digest12-2-2011.JPG]]<br> 

1st Digest PCR product (band 1) with BamH1 , digest pLVXPlus2-IRES-mCherry(174) vector with BamH1 (band2)<br> 

[[Image:493 sfi1 12-2-2011.JPG]]<br> 

2nd Digest PCR product (band 1) with Sfi1 , digest pLVXPlus2-IRES-mCherry(174) vector with Sfi1 (band2)<br> 

[[Image:493 digest detect 12-5-2011.JPG]]<br> 

1st digest (band 1) with BamH1 ,then digest with Sfi1 <br> 

<br> 

Date: 2011-12-12---- 

Notebook:Lu yingying 

Page: 

Clone ID:493 

Experimenters: lu yingying<br>Results<br> 

[[Image:493 clone 12-13-2011.JPG]] 

BamH1 NEB ,&nbsp; for 2 hours ,then Sfil1 ,NEB,&nbsp; for 5 hours in waterbath 

[[Image:493 digest detect 12-16-2011.JPG]]<br> 

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB,&nbsp; for 2 hours in waterbath<br> --[[User:Yingying.lu|Yingying.lu]] 10:06, 16 December 2011 (EST) 

<br> 

== '''Cloning of 493-pLVXPlus2-App-IRES-mCherry'''  ==

'''Purpose:''' Cloning of 493-pLVXPlus2-App-IRES-mCherry by PCR<br> 

'''Date: '''2011-12-21--- 

'''Notebook:''' 

'''Page:''' 

'''Clone ID:493''' 

'''Experimenters:''' yingying 

== '''Results'''  ==

'''[[Image:459+493 PCR 12-19-2011.JPG]]'''<br> method2: 

PCR template is pCMV-SPORT6-App 305 

using these primers<br>App-BamH1-F<br>atcga ggatcc gcc acc atgctgcccagcctggcactg 

App-HindIII-Sfi1-R<br>(gttctt tgagcagatg cagaactaa AAGCTT GGCCAAACAGGC atcgact)<br>agtcgatGCCTGTTTGGCCAAGCTTttagttctgcatctgctcaaagaac 

use HIFi buffer <br> 

'''[[Image:475+477+493 clone 12-21-2011.JPG]]'''<br> 

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB, for 4 hours in waterbath<br> 

{| cellspacing="1" cellpadding="1" border="1" style="width: 359px; height: 96px;"
|-
| <br> 
| band 5<br> 
| band 6<br>
|-
| <br> 
| PCR product '''(smear)'''<br> 
| pLVXPlus2-IRES-mCherry(174)<br>
|-
| digest <br> 
| BamH1 + Sfi1<br> 
| BamH1 + Sfi1<br>
|}

BamH1 NEB ,for 2 hours ,then Sfil1 ,NEB, for 2 hours in waterbath<br> 

=== Subcloning  ===

Date: 

<br> 

=== Colony Screening  ===

Date: 2011-12-29<br> 

[[Image:478+493 digest detect 12-29-2011.JPG]]<br> 

Make miniprep and digest with BamH1 + Sfi1<br> 

&nbsp;<br> <br> 

== '''Result intepretation/Summary'''  ==

== '''Conclusion'''  ==

<br> 

===  ===

<br> 

== '''Cloning of 493-pLVXPlus2-App-IRES-mCherry'''  ==

'''Purpose:''' Cloning of 493-pLVXPlus2-App-IRES-mCherry by PCR<br> 

'''Date: '''2012-1-3 

'''Notebook:''' 

'''Page:''' 

'''Clone ID:493''' 

'''Experimenters:''' yingying 

== '''Results'''  ==

'''[[Image:475+493 PCR 1-4-2012.JPG]]'''<br> 

method3: 

App-Pme1-R &nbsp;&nbsp; gctagagcGTTTAAACttagttctgcatctgctcaaag <br>App-BamH1-F atcga ggatcc gcc acc atgctgcccagcctggcactg. <br>Template&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; pCMV-SPORT6-App 305, use HiFi buffer<br> 

[[Image:493 clone 1-4-2012.JPG]]<br> 

{| cellspacing="1" cellpadding="1" border="1" style="width: 335px; height: 96px;"
|-
| <br> 
| band 5<br> 
| band 6<br>
|-
| <br> 
| PCR product<br> 
| pLVXPlus2-IRES-mCherry(174)<br>
|-
| digest enzyme <br> 
| colspan="2" | BamH1 +Pme1<br>
|}

=== Subcloning  ===

Date: 2011 

<br> 

=== Colony Screening  ===

Date: 2012-1-6<br> 

Make miniprep and digest with BamH1 +Pme1<br> 

[[Image:493+528_digest_detect_1-6-2012.JPG]]

&nbsp;<br> 

<br> 

== '''Result intepretation/Summary'''  ==

*Sequencing Result:<br>

== '''Conclusion'''  ==

<br> 

===  ===

<br> 

[[Category:Cloning]]