Editing Adenovirus Production

== Vector Linearization with PacI ==

1.Digest 5 ul of GOI in pAd5-CMV-MCS shuttle vector and pAd5B (Clone #415, backbone) vector (4.5 ug) with '''PacI.'''

'''Reaction A'''

GOI in pAd5-CMV-MCS miniprep DNA: 5 ul

pAd5B vector (#415) 1 ug (~2 ul of maxiprep DNA)

PacI, 1 ul

Buffer 1, 2&nbsp; ul

10X BSA, 2 ul

Water to 20 ul



Incubate at 37 oC for 2 hour or room temperature O/N.

'''After digestion'''

2. Optional: Run 2&nbsp;ul of each digested DNA and undigested DNA on a 0.8% agarose gel to confirm the completion of PacI digestion





*<strike>Precipitate pAd5B vector with 3M KAc + isopropanol, wash with 75% EtOH, dry in biosafety hood, dissolve in H<sub>2</sub>O.</strike>
*<strike>or:</strike> Purify DNA with Omega miniprep spin column, Elute DNA with 50 ul sterile dH<sub>2</sub>O. Store the digested DNA at -20 °C.



== Transfection ==

1. Seed <strike>2 x 10<sup>6</sup></strike> 293A cells in&nbsp; 6 well plate <strike>a 60 mm culture dish&nbsp; or T25 flask</strike> with antibiotics one day before transfection.



2. After 16 to 24 hours, start transfection when the culture becomes 50% confluence.

&nbsp;&nbsp; Mix digested DNA (GOI in shuttle vector + backbone vector) in 100&nbsp;&nbsp;ul serum-free DMEM--->A

&nbsp;&nbsp; Add 6 ul GeneExpressoMax Transfection Reagent to 100 ul serum-free DMEM--->B

&nbsp;&nbsp; Transfer B to A, mix,&nbsp; incubate for 20 min at room temperature.

&nbsp;&nbsp; Add mixture&nbsp; dropwise into the culture media.

3. Incubate the cells in a 37 <sup>o</sup>C incubator with 5% CO<sub>2</sub> for 5 days. Check for the presence of plaques.



== 1st Round Amplification ==

1.&nbsp;Wash cells with PBS, Use trypsin to digest cells, add 5 ml PBS.&nbsp;Transfer to a clean tube.

2. Spin down cells at max speed (microcentrifuge) for 30 sec, remove PBS and add 0.2 ml fresh PBS.

3. Release viruses from cells by three freeze/thaw cycles ( in 37 oC incubator and dry ice).

4. Add the entire lysate to 10 cm plate or T75 flask with 293A cells (50%) conflucence.

5. When cells are round,&nbsp; (cytopathic effects, CPEs), harvest adenovirus-containing cells by squirting cells off the plate with a 5 or 10 mL sterile serological pipette. Transfer cells and media to a sterile 15 ml tube. Scraping the cells into the medium with a cell lifter, if necessary.

6. Spin down cells, transfer medium to a clean tube, which can be used for futher amplification.&nbsp;&nbsp; Add 0.5 ml PBS to cell pellet.

7. Release viruses from cells by three freeze/thaw cycles (in 37 oC mixer/incubator and dry ice).

8. Centrifuge the cell lysate in a eppendorf centrifuge at 13000 rpm for 2 minutes at room temperature to pellet the cell debris.

9.&nbsp; Transfer the supernatant to a clean tube, add 80% glycerol to a final concentration of 10% glycerol,&nbsp; make 250 ul aliquots, and store the Crude Viral Lysate (Initial Viral Stock, IVS) at -80 °C.

== Mid Scale Amplification ==

1. Seed 3-5 x 10<sup>6</sup> cells in a T75 flask one day before infection.

2. Add 100 ul of the above IVS to the culture. Usually this will give a multiplicity of >0.5 PFU (plaque forming units). This amount of viruses will result in cytopathic effects (CPEs) within 48 hrs.

3. During 24 - 48 hr infection, examine the monolayer twice per day under the microscope for CPE. When CPE is nearly complete (i.e. most cells '''rounded''' '''but not yet detached from the flask'''), harvest cells by pipetting media up and down to wash the infected cells from the flask into the media.

<br/>4. Pool infected cells and medium. Pellet cells by centrifugation at 1000 g for 5 minutes. Remove supernatant, resuspend cell pellet in medium or in PBS or 10 mM Tris, pH 8.0, 100 mM NaCl. (0.25-0.5 mL per T75 flask)

5. Release the adenoviruses from the cell suspension with 4 freeze/thaw cycles. Centrifuge at 3000xg for 10 minutes to pellet the cell debris. Discard the pellet, transfer the supernatant to a clean tube, add 80% glycerol to a final concentration of 10% glycerol, make 250 ul aliquots, and store the&nbsp; Viral Stock (VS)&nbsp; at -80 °C.

== Large Scale Amplification ==

Send to Univ. Michigan

== qPCR ==

[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3679352/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3679352/]

BGH Forward Primer: AATGCGATGCAATTTCCTCAT

BGH Reverse Primer: TGCCTTCCTTGACCCTGG

BGH Probe: [HEX]-TTAGGAAAGGACAGTGGGAGTGGCACC-[BHQ1A]

L2 Forward Primer: TTGTGGTTCTTGCAGATATGGC

L2 Reverse Primer: TCGGAATCCCGGCACC

L2 Probe: [Cy5]-CTCACCTGCCGCCTCCGTTTCC-[BHQ2A]
[[Category:Protocols]]