Editing Amplification of Rabbit VH and VL cDNA by RT-PCR

Amplification of Rabbit VH and VL cDNA by RT-PCR

1. Plasticware: For RNase-free plasticware, see Section 2.1 item 1; 0.2-ml PCR tubes (e.g., MicroAmp 8-Tube strips and 8-Cap strips; Applied Biosystems, Foster City, CA).

2. RNase-free water (Ambion). Store at room temperature.

3. SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA) containing 50 uM oligo(dT),10 mM dNTP mix, 10x RT buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl), 25 mM MgCl2, 100 mM DTT, 40 U/ml RNaseOUT, 200 U/ml SuperScript III RT, and 2 U/ml E. coli RNase H. Store at -20 oC.

4. Primers

Sense primers: RHFabVH1, RHFabVH2, RHFabVH3, RHFabVH4, RHFabVk1, RHFabVk2, and RHFabVL1. 

Antisense primers: rhfabvh5, rhfabvk3, rhfabvk4, rhfabvk5, and rhfabvL2. 

Sequences of all oligonucleotides are given in Table 5.1. 

For a working concentration of 20 mM, dilute stock concentrations (typically 100â500 mM) in water and store at -20 oC.

5. PCR reagents: 5 U/ml Taq DNA polymerase, 10x Taq buffer with (NH4)2SO4, and 25 mM MgCl2 (all from Fermentas, Hanover, MD); 10 mM dNTP mix: 2.5 mM of each dATP, dCTP, dGTP, and dTTP diluted in water from 100 mM stock concentrations (GE Healthcare, Piscataway, NJ). Store at -20 oC.)

RHFabVH1 5' GCTGCCCAAC CAGCCATGGCCCAGTCGGTGGAGGAGTCCRGG-3'<br>RHFabVH2 5'GCTGCCCAACCAGCCATGGCCCAGTCGGTGAAGGAGTCCGAG3'<br>RHFabVH3 5'GCTGCCCAACCAGCCATGGCCCAGTCGYTGGAGGAGTCCGGG3'<br>RHFabVH4 5'GCTGCCCAACCAGCCATGGCCCAGSAGCAGCTGRTGGAGTCCGG3'<br>rhfabvh5 5'CGATGGGCCCTTGGTGGAGGCTGARGAGAYGGTGACCAGGGTGCC3'<br>RHFabVk1 5'GGGCCCAGGCGGCCGAGCTCGTGMTGACCCAGACTCCA3'<br>RHFabVk2 5'GGGCCCAGGCGGCCGAGCTCGATMTGACCCAGACTCCA3'<br>rhfabvk3 5'AGATGGTGCAGCCACAGTTCGTTTGATTTCCACATTGGTGCC3'<br>rhfabvk4 5'AGATGGTGCAGCCACAGTTCGTAGGATCTCCAGCTCGGTCCC3'<br>rhfabvk5 5'AGATGGTGCAGCCACAGTTCGTTTGACSACCACCTCGGTCCC3'<br>RHFabVL1 5'GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGTCGCCCTC3'<br>rhfabvL2 5'AGATGGTGCAGCCACAGTTCGGCCTGTGACGGTCAGCTGGGTCCC3'<br>HCK 5'CGAACTGTGGCTGCACCATCTGTC3'<br>pelb 5'GGCCATGGCTGGTTGGGCAGC3'<br>C-50SFIVL 5'CTGCTGCTGGGCCCAGGCGGCCGAGCTCG3'<br>C-3'sfivh 5'GAGGAGGAGGGCCGACGGGGCCAAGGGGAAGACCGATGGGCCCTTGGTGGAGGCTGA3'<br>VLSEQ 5'GATAACAATTGAATTCAGGAG3'<br>vhseq 5'TGAGTTCCACGACACCGT3'

1. For first-strand cDNA synthesis, process total RNA from rabbit spleen and bone marrow in parallel. In an RNase-free 1.5-ml microcentrifuge tube, dilute 20 ug of the total RNA with RNase-free water to 64 ul, add 8 ul 50 uM oligo(dT) and 8 ml 10mMdNTP mix (total 80 ul) , incubate for 5 min at 65 oC, store on ice for at least 1 min, and collect by brief centrifugation.

2. Prepare reverse transcriptase (RT) reaction mixture by combining 16 ml 10x RT buffer, 32 ul 25 mM MgCl2, 16 ul 100mMDTT, 8 ul 40U/ml RNaseOUT, and 8 ul 200 U/ml SuperScript III RT (total 80 ml) in another RNase-free 1.5-ml microcentrifuge tube.

3. Add the prepared RT reaction mixture to the prepared RNA/oligo(dT)/dNTP sample (total 160 ul), incubate for 50 min at 50 oC, followed by 5 min at 85 oC. Store on ice for at least 1 min and collect by brief centrifugation.

4. Add 8 ml 2 U/ml E. coli RNase H, incubate for 20 min at 37 oC, and collect by brief centrifugation.

5. Store first-strand cDNA at -20oC.

6. For PCR, process first-strand cDNA from rabbit spleen and bone marrow in parallel and each in independent duplicates in 0.2-ml PCR tubes. Each sample will be subjected to 11 primer combinations in separate reactions (see Note 7).

7. For rabbit VH amplification, generate four primer combinations for each sample by combining 2 ml of the first-strand. <br>

[[Category:Antibodies]]