Editing Gene Disruption using Lambda Red


Gene Disruption.

Transformants carrying a Red helper plasmid were grown in 5-ml SOB cultures with ampicillin and L-arabinose at 30°C to an OD600 of ≈0.6 and then made electrocompetent by concentrating 100-fold and washing three times with ice-cold 10% glycerol. PCR products were gel-purified, digested with DpnI, repurified, and suspended in elution buffer (10 mM Tris, pH 8.0). Electroporation was done by using a Cell-Porator with a voltage booster and 0.15-cm chambers according to the manufacturer's instructions (GIBCO/BRL) by using 25 μl of cells and 10–100 ng of PCR product. Shocked cells were added to 1-ml SOC, incubated 1 h at 37°C, and then one-half was spread onto agar to select CmR or KmR transformants. If none grew within 24 h, the remainder was spread after standing overnight at room temperature. After primary selection, mutants were maintained on medium without an antibiotic. They were colony-purified once nonselectively at 37°C and then tested for ampicillin sensitivity to test for loss of the helper plasmid. If it was not lost, then a few were colony-purified once at 43°C and similarly tested.

PCR Verification.

Three PCRs were used to show that all mutants have the correct structure. A freshly isolated colony was suspended in 20-μl water with a plastic tip from which 5-μl portions were used in separate 20-μl PCRs following a 2-min preincubation, “hot start,” at 95°C. Common test primers included: c1 (TTATACGCAAGGCGACAAGG) and c2 (GATCTTCCGTCACAGGTAGG) for cat, and k1 (CAGTCATAGCCGAATAGCCT), k2 (CGGTGCCCTGAATGAACTGC), and kt (CGGCCACAGTCGATGAATCC) for kan. Two reactions were done by using nearby locus-specific primers with the respective common test primer (c1, c2, k1, or k2) to test for both new junction fragments. A third reaction was carried out with the flanking locus-specific primers to verify simultaneous loss of the parental (nonmutant) fragment and gain of the new mutant-specific fragment. The latter was repeated after elimination of the resistance gene. A fourth reaction was sometimes done with primers k2 and kt to test for a 471-nt kan fragment. Control colonies were always tested side-by-side.

Eliminating Antibiotic Resistance Gene.

pCP20 is an ampicillin and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis (26). CmR and KmR mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30°C, after which a few were colony-purified once nonselectively at 43°C and then tested for loss of all antibiotic resistances. The majority lost the FRT-flanked resistance gene and the FLP helper plasmid simultaneously. [https://www.pnas.org/content/97/12/6640.long#F2 https://www.pnas.org/content/97/12/6640.long#F2]


https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748948/
E. coli Lambda-red recombineering
Briefly, a 2 ml overnight culture (LB medium) inoculated from a single colony obtained from a plate was grown at 30 °C. The overnight culture was diluted 100-fold and grown at 30 °C with shaking (200rpm) until the OD600 is from 0.4–0.5 (approximately 3 hrs). For Lambda-red induction, the culture was transferred to a 42 °C water bath to shake at 200rpm for 15 min. Immediately after induction, the culture was swirled in an ice-water slurry and chilled on ice for 5–10 min. Cells were then washed and aliquoted according to the protocol. For electro-transformation, 50 µl of cells were mixed with 1mM of salt-free oligos (IDT) or 100–150 ng of plasmid DNA (prepared by QIAprep Spin Miniprep Kit, Qiagen). Cells were electroporated using 1mm Gene Pulser cuvette (Bio-rad) at 1.8kV and were immediately resuspended in 1 ml of room temperature LB medium. Cells were recovered at 30 °C for 1–2 hrs before being plated on LB agar with appropriate antibiotic resistance and incubated at 32 °C overnight.


[[Category:Protocols]]