Editing GoldenGate TALEN Assembly

== Materials  ==

=== '''Reagents''' <br>  ===

A) Set of 60 library vectors<br>B) 10X T4 DNA ligase buffer (NEB)<br>C) Quick ligase or T-4 DNA ligase (NEB)<br>D) restriction endonuclease BsaI (NEB)<br>E) restriction endonuclease Esp3I (Fermentas or Fisher [FERER0452])<br>F) Plasmid-Safe nuclease (Epicentre Biotechnologies E3110K )<br>G) 10mM ATP<br>H) chemically competent cells<br>I) SOC<br>J) LB plates and liquid media with Tetracycline (10mg/l), Spectinomycin (50mg/l),<br>Ampicillin (50mg/l)<br>K) X-gal/IPTG<br>L) Miniprep kit (Qiagen)<br><br> 

=== '''Primers'''  ===

For screening/sequencing of transformants:<br><br>pCR8_F1: ttgatgcctggcagttccct<br>pCR8_R1: cgaaccgaacaggcttatgt<br>TAL_F1: ttggcgtcggcaaacagtgg<br> 

Day3<br><br>Mini prep Miniprep the plasmids: Use enzymes AflII and XbaI to digest<br><br>TAL_R2: ggcgacgaggtggtcgttgg<br>SeqTALEN_5-1 catcgcgcaatgcactgac (use this for sequencing in place of TAL_F1)<br><br> 

=== '''Restriction endonucleases'''  ===

– for restriction screening (NEB)<br>AflII<br>XbaI<br>BstAPI or StuI<br>AatII<br>BspEI<br><br> 

== '''Protocol '''  ==

=== DAY1<br>  ===

<br>1. Choose your TALEN RVD sequence: N = number of RVDs (12-31) <br><br> 

'''If the TALEN length is 12-21:'''<br>2. Pick plasmids for the RVDs 1-10 (e.g. pNI1, pNN2, pHD3, pHD4....) + destination vector pFUS_A<br>3. Pick plasmids 11 up to N-1 + destination vector pFUS_B#N-1 (pFUS_B plasmids are labeled B1-B10 but they are used for RVDs 11-30 – if<br>the RVD #N-1 is 19 or 29, use the same destination vector pFUS_B9)<br> 

<br>'''If the TALEN length is 22-31:'''<br>2. Pick plasmids for the RVDs 1-10 + destination vector pFUS_A30A, pick plasmids for the RVDs 11-20 + destination vector pFUS_A30B<br>3. Pick plasmids 21 up to N-1 + destination vector pFUS_B#N-1<br>Note: pFUS_B plasmids are labeled B1-B10 but they are used for RVDs 11-30 – if the RVD #N-1 is 19 or 29, use the same destination vector pFUS_B9)<br>4. Mix golden gate reaction #1 – for each set of vectors separately:<br>1-10 + pFUS_A;<br>11-(N-1) + pFUS_B(N-1)<br>or<br>1-10 + pFUSA30A<br>11-20 + pFUSA30B<br>21-(N-1) + pFUS_B(N-1)<br>a) 150 ng of each module vector + 150 ng of pFUS vector.<br>b) 1μl BsaI<br>c) 1μl Quick ligase or T-4 DNA ligase (QL is higher efficiency, but T-4 is much cheaper and works fine). 

<br>d) 2μl 10X T4 DNA ligase buffer (to final concentration of 1X) 

Note: If T7 ligase is used, add 2 ul of NEB Buffer 4 and 1 ul of 10 mM ATP<br>e) H2O up to 20μl total reaction volume 

<br><br> 

Note: Published protocol indicates using 20μL reactions, but it was found that 10μL reactions are reliably effective (same concentrations as in published protocol). Use 1⁄2 reactions (same concentrations, only 10μL total volume) can save some reagent. If a particular cloning reaction is somewhat difficult (failed more than once), it may be useful to use a 20μL reaction.<br> 

<br> 

5. Run cycle: 

10 cycles of (37 ̊C for 5min + 16 ̊C for 10min) 

then 50 ̊C for 5min

and 80 ̊C for 5min <br> 

With this cycle you will get hundreds of white colonies with 90-100% efficiency.

you can also use 20 oC instead of 16 oC<br><br> 

6. Plasmid-Safe nuclease treatment: this destroys all unligated linear dsDNA fragments including incomplete ligation products with lower number of repeats<br>fused; and cut and linearized vectors. The incomplete, shorter fragments would be cloned into the destination vector in vivo by recombination in the bacterial cell, if not removed (the start of the first repeat and the end of the last repeat are in the destination vector backbone, so the backbone has homology to each repeat module as they differ only in RVDs) <br> 

<br>To each of your golden gate #1 reactions add:<br>a) 1ml 10mM ATP<br>b) 1ml Plasmid-Safe nucleaseDay3&lt;br&gt;<br><br>Mini prep Miniprep the plasmids: Use enzymes AflII and XbaI to digest&lt;br&gt;<br><br>Incubate at 37 ̊C for 1h 

<br>Note: The Plasmid-Safe nuclease manual says you should inactivate the enzyme by heating the reaction to 70 ̊C for 30 minutes, but our experience, for bacterial transformatin, inactivation is not necessary<br> 

<br>7. Transform your chemically competent DH5alpha, Top10, or MACH with 10 ul reaction.<br> 

<br>8. Plate on Spec50 plates + 40μL of 20mg/mL X-gal +40μL of 0.1M IPTG. 

If STBL3 is used do not add X-Gal and IPTG as STBL3 can not be used for blue white screening. 

When plating transformations of the pFUSB vectors that have fewer repeats (especially less than 6 repeats), be careful to not plate all the cells as the efficiency is so high you can’t pick single colonies on day 2.<br><br> 

=== DAY2<br>  ===

<br>9. Pick 1-3 white colonies from each plate and check by colony PCR using primers pCR8_F1 and pCR8_R1 (primers are the same for each pFUSA, pFUSA30A,<br>pFUSA30B, pFUSB1-10 vector). 

PCR program: 

Anneal at 55 oC, extend 1.75 min, 30-35 cycles 

You should get a band around your expected size (~1.2KB for vectors with 10 repeats), but you will also get smearing and a ‘ladder’ of bands starting at ~200bp and every 100bp up to ~500bp. This is the sign of a correct clone and is the result of the repeats in the clones.<br><br> 

Example of Colony PCR results for pFUS vectors:<br>[[Image:TALEN PCR Screening1.jpg]] 

Note: Lanes 1 and 2 are negative pFUS clones (empty). Lane 3 contains the ‘correct’ clone for this pFUS. pFUS clones that only contain 1 or 2 repeats are very similar in size to empty pFUS clones – check the size carefully. Lanes 4,5,6,10,11,12 show the ‘laddering’ effect well. DNA ladder is NEB’s 2Log<br><br> 

10. Start the over-night cultures with the correct clones <br> 

=== <br>DAY3<br><br>  ===

11. Miniprep the plasmids: 

<br>pFUS_A with first 10 repeats cloned (A)<br>pFUS_B with 11-(N-1) repeats cloned (B)<br>or<br>pFUS_A30A with first 10 repeats cloned (A1)<br>pFUS_A30B with second 10 repeats cloned (A2)<br>pFUS_B with 21-(N-1) repeats cloned (B)<br><br> 

12. Optional restriction digestion testing/sequencing:<br>Use enzymes '''AflII and XbaI '''(same for all destination vectors) to cut out the array of fused repeats: 1'''048bp for pFUS_A '''vectors, '''different sizes '''depending on number of repeats cloned for '''pFUS_B''' vectors and/or sequence with primers pCR8_F1, pCR8_R1 

<br>13. Mix golden gate reaction #2 

a) 150ng of each vector A and B (or A1, A2 and B)<br>b) 150ng of respective pLR vector – this is the vector containing the last “half-repeat” including the last RVD, choose it according to your TALEN sequence – it is the last RVD in the sequence (there are 5 pLR vectors – pLR-HD, pLR-NG, pLR-NI, pLR-NN, pLR-NK)<br>c) 75 ng of Donor vector pTAL1, 2, 3, or 4<br> 

or <br> 

1490 pCAG-T7-TALEN(Sangamo)-FokI-ELD-Dest for left<br> 

1489 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Dest for right<br> 

or 1488&nbsp; pCAG-T7-TALEN for both left and right<br> 

<br>d) <strike>1</strike>&nbsp;&nbsp;&nbsp; 0.5&nbsp; μl Esp3I (BsmBI)<br>e) 0.5 μl Quick ligase or T-4 Ligase (this reaction is so efficient that T-4 ligase is always sufficient)<br>f) <strike>2</strike>&nbsp; 1 μl 10X T4 DNA ligase buffer or '''Tango buffer''' (the buffer for the Esp3I enzyme)<br>g) H<sub>2</sub>O up to <strike>20</strike>&nbsp; 10 μl<br><br>14. Run cycle: 10x(37 ̊C for 5min + 16 ̊C for 10min) + 37 ̊C for 15min + 80 ̊C for 5min for hundreds of white colonies, 

<strike>OR 37 ̊C for 10min + 16 ̊C for 15min + 37 ̊C for 15min + 80 ̊C for 5min for tens of white colonies*.&nbsp; This 1 cycle reactions is sufficient for the second GG reaction, and this is what the Voytas lab usually does.</strike><br> 

<br>15. Transform your competent cells (use 10 ul of the reaction) <br>Note: Plasmid-Safe nuclease treatment is not necessary in this case, because the final destination vector has no homology with the inserted repeats<br> 

<br> 

16. Plate on '''Carb(Amp)50''' plates + X-gal and IPTG (see above). After you gain confidence/experience with the GG (goldengate) cloning, it’s reasonable to skip the IPTG/X-gal for the pTAL cloning.<br><br><br> 

=== DAY4<br><br>  ===

<br>17. Pick 1-3 white colonies and check by colony PCR using primers TAL_F1 and TAL_R2 using these conditions:<br>a. Anneal at 55<sup>o</sup>C, extend 3 minutes, cycle 30-35X<br> 

b. Very often, you can’t see the band of the size you expect, but instead see a smear and the ‘ladder’ effect – again, this is the sign of a correct clone.<br><br> 

18. Run on a gel, choose a correct clone and start an over-night culture <br> 

Example of Colony PCR results:<br> 

[[Image:TALEN PCR screening.jpg]] 

Note that in lane 5, you don’t see very much ‘smear’ around 3KB (Ladder is NEB’s 2Log), which indicates that this clone is NOT correct. In most other cases in the above gel you can see faint bands around 2-3 KB, which are the correct length for the completed TALs in the picture above. For TALs with &gt;22 repeats, it is common to fail to amplify enough full-length TAL to see on a gel, however if you can see the ‘smear’ those clones are almost always correct. The ‘ladder effect’ is evident in some of the lanes (4, 11,12,13).<br> 

=== <br>DAY5<br><br>  ===

19. Miniprep the pTAL vectors containing your final full-length TALEN<br><br> 

20. Optional restriction digestion testing/sequencing: 

<br>Use enzymes BstAPI (or '''StuI''') and '''AatII''' to cut out the final array of repeats –check on a gel.&nbsp; You can use BspEI enzyme, which cuts only in HD repeats (except HD1 repeats) – on the gel you’ll get a pattern resembling your TALEN sequence and HD.<br> 

<br> 

21. Your TALEN is ready to use in a yeast-based DNA cleavage assay. Or further cloning, you can cut the TALE domain out using BamHI or combination of XbaI and EcoRV (blunt) repeats position 

<br>Note: there is no BspEI site in the first (i.e. #1) and the last (i.e. #N) HD repeat and sequence with primers SeqTALEN 5-1 and TAL_R2<br><br> 

<br> 

== '''Results '''  ==

Day2, pick white clones to PCR using primers pCR8_F1 and pCR8_R1&nbsp;: 

[[Image:SMN2---1 TOP1 1-8 and TOP2 1-8.JPG]]<br> 

<br> 

[[Image:SMN2---SMN1 BOTTOM1 1-8 AND BOTTOM2 1-8.JPG]]<br> 

Day3<br> 

&nbsp;Miniprep the&nbsp; plasmids: Use enzymes AflII and XbaI to digest<br> 

[[Image:Smn2--smn1digest 11 02-2012.JPG]]<br> 

Top1-5,Top1-8,Bottom1-1, Bottom2-1,Bottom2-4,Bottom2-5 may be right.<br> 

<br> 

TransformTOP2 again.<br> 

Day4, pick white clones to PCR using primers pCR8_F1 and pCR8_R1&nbsp;: <br> [[Image:SMN2---1 TOP2 1-14pcr.JPG]] 

Day5<br> 

Mini prep Miniprep the plasmids: Use enzymes AflII and XbaI to digest<br> 

[[Image:Smn2--smn1digest 11 05-2012.JPG]]<br> 

Top2-8,Top1-12,Top1-14 may be right.<br> 

<br> 

Sequence TOP1-5,BOTTOM1-1,BOTTOM2-1 and top2-8,top2-14 with primers pCR8_F1 and pCR8_R1.<br> 

TOP1-5,BOTTOM1-1,BOTTOM2-1 are right.<br> 

Top2-8,Top2-14 are empty vectors, so need to repeat step1.<br> 

<br> 

<br> 

TOP2 .<br> again, pick white clones to PCR using primers pCR8_F1 and pCR8_R1&nbsp;: [[Image:Smn2--1top2.JPG]]<br> 

golden gate reaction #2 BOTTOM<br> 

Pick white colonies and check by colony PCR using primers TAL_F1 and TAL_R2<br>[[Image:SMN2---1BOTTTOM.JPG]]<br> 

Mini prep TOP2&nbsp;: Use enzymes AflII and XbaI to digest<br> 

[[Image:Top2digest with AfIII AND xbaI.JPG]] 

= [[Image:SMN21BOTTOM11-13 AND 11-14 DIGEST WITH StuI AND AtaII.JPG]]<br>  =

[[Category:Protocols]] [[Category:GenomeEngineering]]