Editing Lambda Red Protocol

{{back to protocols}}

== Overview ==

Single-gene knockouts using λ red system, adapted from [http://www.pnas.org/cgi/content/full/97/12/6640 Datsenko and Wanner] paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

Since the λ red system can introduce unintended mutations, often people move the knockout to a fresh strain after it is verified. [https://sites.google.com/site/dominikrefardt/phage-cookbook/recombineering P1 transduction] can be used to do this.

== Materials ==

''Not a complete list — see protocol for details, or update this list'' --[[User:ShawnDouglas|smd]] 20:20, 5 March 2007 (EST)

*plasmids
**'''pKD46'''
***pKD46 carries the λ red genes behind the araBAD promoter & is temperature sensitive (grow at <= 32 °C to maintain the plasmid). Use Ampicillin.
**'''pKD3''' (chloramphenicol) or '''pKD4''' (kanamycin)
***pKD3 = chloramhenicol resistance cassette. Require the pir gene product for replication, which means that a carry-over of the plasmids (and false positives) is not possible. The resistance cassettes is flanked by FRT sites, which allow the removal of the cassettes once inserted in the bacterial chromosome with a FLP helper plasmid.
****pKD4 = kanamycin resistance version, if needed instead.
**'''pCP20''' (optional)
***pCP20 contains a temperature-inducible flp gene for removing the chloramphenicol resistance gene you will introduce. Also confers ampicillin & chloramphenicol resistance.
*reagents
**L-arabinose
*equipment
**incubators (30°C and 37°C)
**electroporator

== Procedure ==

*'''General outline'''
**Grow up pKD46, pKD3, and pCP20 in host strains
***pKD46 should be grown at <= 32oC to maintain the temperature sensitive plasmid.
**Perform minipreps to extract plasmids
**Transform pKD46 into target strain, plate out on LB-amp plates
**PCR amplify linear fragment from pKD3 or pKD4 using oligos ''A'' and ''B'' (see below for design)
**Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
**Electroprate linear DNA into electrocompetent cells
**Grow at 37°C on chloramphenicol plates
**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)
*'''Detailed procedure'''
*'''Day 0: Start overnight culture'''
**Start overnight culture of strain containing gene to knock out.
*'''Day 1: Preparation and transformation of competent cells'''
**Make new glycerol stock of overnight strain (grown from single colony)
**Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution)
**Check culture density every 30 minutes starting at +1 hour; grow to {{od|600}} of 0.3 to 0.4
**{{od|600}} measurements of K91
***+2:00 hrs: 0.06
***+2:45 hrs: 0.3008
**Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
**Decant supernatant, discard
**Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
***'''Transformation Buffer'''
***10 mM Pipes
***15 mM {{cacl2}}
***250 mM KCl
***Titrate to pH 6.7 before adding {{mncl2}}
***55 mM {{mncl2}}
***Filter sterilize
**Incubate on ice for 10 min
**Spin at 2500rcf for 10 minutes at 4°C
**Decant supernatant, discard
**Resuspend each pellet in 1.25 mL ice cold transformation buffer
**Combine resuspended pellets in single tube
**Remove 400 {{ul}} for immediate transformation
**Add DMSO to a final concentration of 7% (160 {{ul}}). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
**Incubate on ice for 10 min
**Aliquot 400 {{ul}} each into five 1.5 mL tubes
**Store in -80°C freezer.
**Transform strain with pKD46 and grow on LB-amp plate at 30°C
***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
***Add 100 {{ul}} of competent cell mix to each tube
***Incubate on ice 30 min
***Heat shock 30 seconds at 42°C
***Incubate on ice 2 min
***Spread all 100 {{ul}} on LB-amp-kan plate
***Incubate at 30°C overnight
**U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
**PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
***PCR program: 95°C 7min → 35*[94°C 15s → 50°C 30s → 72°C 90s]

::

{|
|-
| align="center" style="background:#f0f0f0;" | '''Contents'''
| align="center" style="background:#f0f0f0;" | '''Concentration'''
| align="center" style="background:#f0f0f0;" | '''Volume'''
|-
| pKD3 template
| 45 ng/{{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
| 0.5 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| forward primer
| 10 {{um}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;μM</span>
| 5 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| reverse primer
| 10 {{um}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;μM</span>
| 5 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| 10x KOD buffer
| -
| 10 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| dNTP
| 2 mM
| 10 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| {{mgso4}}
| 25 mM
| 4 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| KOD polymerase
| 
| 2 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|-
| d{{h2o}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">H</span><sub style="line-height: 1; color: rgb(0, 0, 0); font-family: sans-serif;">2</sub><span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">O</span>
| -
| 64.5 {{ul}}<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">μL</span>
|}



*
*Make ten 10 {{ug}}/ml chloramphenicol plates and ten 25 {{ug}}/ml chloramphenicol plates

*'''Day 2'''
**Make 1 M stock of L-arabinose
***MW of L-arabinose is 150.13
***Add 1501.3 mg of L-arabinose to 8.5 g d{{h2o}} to make 1 M stock
**Retrieve plates from incubator
**Check results from the transformation
***1 ng pKD46 transformation yielded about 10 colonies
***10 ng pKD46 transformation yielded about 100 colonies
***100 ng pKD46 transformation yielded several hundred colonies
**Pick some colonies and grow at 30°C in 2 mL LB + 50 {{ug}}/mL Amp
***add 50 {{ul}} 10 mg/mL Ampicillin stock
**Include enough samples for two conditions: +/- L-arabinose induction
**When {{od|600}} of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
***add 20 {{ul}} 1 M L-arabinose to 2 mL culture
**Continue to grow at 30°C to {{od|600}} = 0.4
**Aliquot 1 mL each into two 1.5 mL centrifuge tubes
**Chill cells in ice-water bath 10 minutes
**Centrifuge 10 min at 4000rcf 4°C
**Pipette off supernatant and resuspend pellets in 1 mL ice-cold d{{h2o}}
**Centrifuge 10 min at 4000rcf 4°C
**Resuspend pellet in 50 {{ul}} d{{h2o}}
**For electroporation step, include 2 conditions: +/- PCR fragment
**Chill electroporation cuvettes for 5 minutes on ice
**Add 5 pg to 0.5 {{ug}} PCR amplified DNA to cells
**Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
**Place the cuvette into the sample chamber
**Apply the pulse by pushing the button
**Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
**Incubate 60-120 min with moderate shaking at 37°C
**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 25 {{ug}}/mL)

== Notes ==

'''Designing necessary primers'''

*First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
**[http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=15554329 NCBI sequence viewer: pKD3]
***priming site 1: {{blue|GTGTAGGCTGGAGCTGCTTC}}<span style="color: rgb(0, 0, 255); font-family: sans-serif; font-size: 12.7px;">GTGTAGGCTGGAGCTGCTTC</span>
***priming site 2: {{purple|GGACCATGGCTAATTCCCAT}}<span style="color: rgb(128, 0, 128); font-family: sans-serif; font-size: 12.7px;">GGACCATGGCTAATTCCCAT</span>
***priming site 2 reverse complement: {{green|ATGGGAATTAGCCATGGTCC}}<span style="color: rgb(0, 128, 0); font-family: sans-serif; font-size: 12.7px;">ATGGGAATTAGCCATGGTCC</span>



*pKD3 Cat sequence (1034 bases)

<span style="color: rgb(0, 0, 255); font-family: Courier, monospace; font-size: 12.7px;">GTGTAGGCTGGAGCTGCTTC</span><span style="font-family:Courier,monospace;">{{blue|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATAT{{purple|GGACCATGGCTAATTCCCAT}}</span><span style="color: rgb(128, 0, 128); font-family: Courier, monospace; font-size: 12.7px;">GGACCATGGCTAATTCCCAT</span>

*<span style="font-family:Courier,monospace;">Next, find the sequence (and context sequence) of the gene you wish to remove </span>
**<span style="font-family:Courier,monospace;">In this example, I found the sequence and context for endA (808 bases total) </span>
***<span style="font-family:Courier,monospace;">MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream</span>

<span style="font-family:Courier,monospace;"><span style="font-family:Courier,monospace;">{{orange|
CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}</span></span><span style="color: rgb(255, 165, 0); font-family: Courier, monospace; font-size: 12.7px;">CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG</span><span style="font-family:Courier,monospace;"><span style="font-family:Courier,monospace;">ATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG</span></span>

<span style="font-family:Courier,monospace;"><span style="font-family:Courier,monospace;">CAACGCGCTTGCCAGGCGCGAAAGAGCTAA{{red|CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC}}</span></span><span style="color: rgb(255, 0, 0); font-family: Courier, monospace; font-size: 12.7px;">CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC</span>

*<span style="font-family:Courier,monospace;">Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA). </span>
**<span style="font-family:Courier,monospace;">Forward primer: ''A'' </span>
***<span style="font-family:Courier,monospace;">{{orange|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue|GTGTAGGCTGGAGCTGCTTC}}</span><span style="font-family: sans-serif; font-size: 12.7px; color: orange;">CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG</span><span style="font-family: sans-serif; font-size: 12.7px; color: blue;">GTGTAGGCTGGAGCTGCTTC</span>
**<span style="font-family:Courier,monospace;">Reverse primer: ''B'' </span>
***<span style="font-family:Courier,monospace;">{{red|GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGG}}{{green|ATGGGAATTAGCCATGGTCC}}</span><span style="font-family: sans-serif; font-size: 12.7px; color: red;">GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGG</span><span style="font-family: sans-serif; font-size: 12.7px; color: green;">ATGGGAATTAGCCATGGTCC</span>

*<span style="font-family:Courier,monospace;">Construct primers that only flank the target gene (endA) for PCR verification </span>
**<span style="font-family:Courier,monospace;">Forward primer: ''C'' </span>
***<span style="font-family:Courier,monospace;">{{orange|CCAAAACAGCTTTCGCTACGTTGCT}} </span><span style="color: rgb(255, 165, 0); font-family: sans-serif; font-size: 12.7px;">CCAAAACAGCTTTCGCTACGTTGCT</span><span style="font-family:Courier,monospace;">(25 bases)</span>
**<span style="font-family:Courier,monospace;">Reverse primer: ''D'' </span>
***<span style="font-family:Courier,monospace;">{{red|GGTTGTACGCGTGGGGTAGGGGTTA}} </span><span style="color: rgb(255, 0, 0); font-family: sans-serif; font-size: 12.7px;">GGTTGTACGCGTGGGGTAGGGGTTA</span><span style="font-family:Courier,monospace;">(25 bases)</span>

*<span style="font-family:Courier,monospace;">Figure out the sequence and size of what you should expect if everything works. In this case, it's Cat inserted into endA flanking region'''(1132 bases total)'''</span>

<span style="font-family:Courier,monospace;"><span style="font-family:Courier,monospace;">{{orange|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue|GTGTAGGCTGGAGCTGCTTC}}</span></span><span style="font-family: Courier, monospace; font-size: 12.7px; color: orange;">CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG</span><span style="font-family: Courier, monospace; font-size: 12.7px; color: blue;">GTGTAGGCTGGAGCTGCTTC</span><span style="font-family:Courier,monospace;"><span style="font-family:Courier,monospace;">GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCC ACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACA CGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAAC AAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGA TAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAA ATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTA TCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAG GAACTAAGGAGGATATTCATAT{{purple|GGACCATGGCTAATTCCCAT}}{{red|CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC}}</span></span><span style="color: rgb(255, 0, 0); font-family: Courier, monospace; font-size: 12.7px;">CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC</span>

== <span style="font-family:Courier,monospace;">References</span> ==

<span style="font-family:Courier,monospace;">'''Literature''' &lt;biblio&gt;</span>

#<span style="font-family:Courier,monospace;">[[http://dx.doi.org/10.1073/pnas.120163297|Datsenko KA and Wanner BL.&nbsp;''One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.''&nbsp;Proc Natl Acad Sci U S A. 2000 Jun 6;97(12):6640-5.]]<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;</span>[[http://dx.doi.org/10.1073/pnas.120163297| <span style="font-variant-numeric: normal; font-variant-east-asian: normal; font-variant-caps: small-caps;">DOI:</span>10.1073/pnas.120163297]]<span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;|</span><span class="noprint" style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;[[https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=10829079| <span style="font-variant-numeric: normal; font-variant-east-asian: normal; font-variant-caps: small-caps;">PubMed ID:</span>10829079]]&nbsp;|&nbsp;[[http://www.hubmed.org/display.cgi?uids=10829079| <span style="font-variant-numeric: normal; font-variant-east-asian: normal; font-variant-caps: small-caps;">HubMed</span>]]</span><span style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;">&nbsp;</span><span class="noprint" style="color: rgb(0, 0, 0); font-family: sans-serif; font-size: 12.7px;"><span style="color: rgb(170, 170, 170);">[Datsenko-PNAS-2000]</span></span></span>

<span style="font-family:Courier,monospace;">'''λ red Links'''</span>

*<span style="font-family:Courier,monospace;">[http://www.genome.wisc.edu/functional/tnmutagenesis.htm Schematic Overview]</span>
*<span style="font-family:Courier,monospace;">[http://falkow.stanford.edu/whatwedo/general/wanner.pdf Protocol from Charlie Kim]</span>

<span style="font-family:Courier,monospace;">'''endA Links'''</span>

*<span style="font-family:Courier,monospace;">[http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=full_report&list_uids=949092 Entrez Gene: endA]</span>
*<span style="font-family:Courier,monospace;">[https://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009661 ASAP annotation for K12 endA]</span>

== <span style="font-family:Courier,monospace;">Contact</span> ==

*<span style="font-family:Courier,monospace;">[[User:ShawnDouglas|Shawn Douglas]] — posted original protocol, performed once in August 2006.</span>





PCR-product mediated Knockouts a la Datsenko and Wanner (PNAS, 2000)<br/>Charlie Kim<br/>October 2001, modified June 2002, updated June 2004<br/>PCR<br/>Use pKD3 (Cm) or pKD4 (Kan) if you would like to knockout a gene with minimal polarity effects on downstream<br/>genes.<br/>Use pKD13 (Kan), pKD32 (Cm), or pKD81 (Kan from Tn903) to knockout entire operons, single genes, or any<br/>other situation in which polarity shouldn’t matter.<br/>1. Do PCR. I use 50 ul reactions<br/>2. Check PCR product on gel<br/>3. MinElute purify the reaction(s), eluting in 10 ul ddH2O pH 7.0-8.5 (our water is around pH 6)<br/>Alternatively, you can do 1-3 PCR reactions and combine them in a single QIAQuick PCR cleanup. Speedvac<br/>to concentrate if necessary/desired. Lately, I’ve just been doing just 1 PCR reaction and doing a standard<br/>Qiaquick. I electroporate 2-5 ul of this, and it works fine.<br/>Electroporation

Because this technique demands electroporation and linear DNA recombination in a single step, the yield of colonies<br/>is generally low. I often see 1-2 colonies from my transformations, but I’ve also recovered as many as 150. My<br/>belief is that one of the most important things is to get the competent cells as dense as you can without causing the<br/>electroporation to arc.<br/>1. Grow cells 5-50 ml 2XYT + 100 ug/ml Amp LT2/pKD46 (I’ve also successfully made knockouts in<br/>TR7065/pKD46 (aka LB5010/pKD46) and 14028S/pKD46, but these strains are not as good for P22<br/>production) – 4-6 hours 30 - 32 degrees C. 10 ml is generally sufficient for doing one knockout.<br/>2. Induce the Red recombinase with 10 mM L-arabinose for 1 hour (inducing for the entire time works fine,<br/>too).<br/>3. Harvest in small rotor floor centrifuge, 10 min 8k rpm<br/>4. Resuspend pellet in 1 ml cold ddH2O (I find that my transformations work fine without any glycerol), spin<br/>30 sec in high-speed Eppendorf microfuge (14k rpm in Eppendorf 5417C)<br/>5. Wash 4 more times as in step 4. (Note: I do these quick washes for speed and convenience; you can<br/>certainly use a standard washing protocol in a big centrifuge, but this way, I can get all of my washes done<br/>in 5 minutes).<br/>6. Resuspend in 40-250 ul cold ddH2O. Generally, I find that about 1.5X – 2X the pellet volume results in<br/>good density (high, but not enough to cause arcing with cells alone).<br/>7. Electroporate (I use 2 mm gap cuvettes, 2.5 kV), recover at 37 degrees C in 1 ml 2XYT. I recover in the<br/>cuvette without agitation for convenience. Recovery up to 3 hours may be worthwhile, but after that I’ve<br/>never seen any increase in yield of clones.<br/>8. Plate on LB with antibiotic, incubate at 37 degrees C<br/>Additional Notes<br/>1) While 1 mM L-arabinose seems to work fine for E. coli, 10 mM seems to work better for Salmonella in my<br/>hands.<br/>2) It is important to titrate your drug concentrations. I had low efficiencies making Cm(R) strains, but I now<br/>know that it was because I was simply using too high a concentration. I went from 30 ug/ml down to 8<br/>ug/ml and the efficiency is similar to making Kan(R) knockouts.<br/>3) I don’t think that the length of arabinose induction is critical, because I’ve obtained mutants inducing for<br/>the entire growth of the culture or for just 1 h before harvesting. I tend to do it for just 1 h before<br/>harvesting because I have the vague notion that I get more recombinants this way, but I’ve never tested this<br/>rigorously.&nbsp;