Editing Phusion Polymerase

== Protocol for harvesting&nbsp;pfu-sso7d&nbsp;(aka Phusion) polymerase ==

This protocol is for expressing and purifying the high fidelity&nbsp;pfu-sso7d&nbsp;polymerase [1] from&nbsp;E. coli. This protein is sold as Phusion polymerase by&nbsp;New England Biolabs. This&nbsp;pfu&nbsp;variant has the&nbsp;sso7d&nbsp;processivity-enhancing domain attached that increases its speed and processivity. It generates blunt-end DNA products and typically you use higher annealing temperatures than when using&nbsp;taq.

See the&nbsp;NEB website&nbsp;for a description of other key enzyme characteristics.

Expression plasmid sequence:&nbsp;6his-pfu-sso7d-pET28.gbk

Materials needed:

Glycerol stock of EQ458&nbsp;E. coli&nbsp;cells<br/>The strain used is named EQ458. It is located in common species box; this is a&nbsp;Rosetta 2 (DE3) E. coli strain&nbsp;containing 6his-pfu-sso7d-pET28 plasmid. The plasmid is KanR and the strain itself is CamR. The frozen stock is overnight growth of a single colony.<br/>LB medium.&nbsp;Link to LB recipe<br/>Chloramphenicol stock.&nbsp;Link to Cam recipe<br/>Kanamycin stock.&nbsp;Link to Kan recipe<br/>Refrigerated centrifuge.<br/>Spectrophotometer and cuvettes.<br/>French press. Georgiou lab, MBB, 3.310, ask before using.<br/>IPTG, 100 mM stock. Dissolve 2.38 g IPTG in 100 mL deionized water. Filter sterilize and store at –20°C.<br/>Disposable plastic columns.&nbsp;ThermoSci, cat #29922<br/>Ni-NTA agarose resin.&nbsp;Qiagen, cat #30210, 25 ml<br/>Slide-A-Lyzer, 10k dialysis cassette G2.&nbsp;ThermoSci, cat# 87730

Lysis Buffer:

50 mM NaH2PO4<br/>300 mM NaCl<br/>10mM Imidazole<br/>Adjust pH to 8.0 using NaOH

Wash Buffer:

50 mM NaH2PO4<br/>300 mM NaCl<br/>40mM Imidazole<br/>Adjust pH to 8.0 using NaOH

Elution Buffer:

50 mM NaH2PO4<br/>300 mM NaCl<br/>250 mM Imidazole<br/>Adjust pH to 8.0 using NaOH

Polymerase storage buffer: Make 3-4 Liters&nbsp;

50% Glycerol<br/>100 mM Tris/HCl pH 8.0<br/>0.2 mM EDTA<br/>0.2% NP-40; nonionic detergent<br/>0.2% Tween20<br/>2 mM DTT (add immediately before use)

IMPORTANT: Add fresh DTT immediately before use by freshly dissolving it from powder or from a 1 M stock stored at –20°C. We have observed rapid loss of function of enzyme when it is diluted in old storage buffer that has been stored at room temperature.

Protein Expression

Scaled for 2 x 500 mL cultures

Day –1: Revive and Isolate Colony

Streak LB plate supplemented with Kan and Cam from frozen stock of EQ458. Growth plate overnight at 37°C.

Day –2: Precondition

Select single colony from O/N streak plate and inoculate 1.5 mL of LB broth supplemented with Kan and Cam. Grow overnight at 37 C shaking at 250 rpm.

Day –1: Induce

Use 500 µL of overnight culture to inoculate 500 mL of supplemented LB broth (in 2 L flask), grow as before for ~ 3-4 hours until an OD600 of between 0.4 and 0.6 is reached.<br/>Induce the cultures to express proteins by adding IPTG at a final concentration of 0.5 mM (2.5 mL per 500 mL) followed by overnight growth at 18 C, 250 rpm.

Day 0: Harvest

Collect cells by centrifugation. Conditions as follows: 4°C, at 10,000 x g for 15 mins.<br/>Resuspend each cell pellet with 3 mL of lysis buffer and combine tubes together, mix well using pipette.<br/>French press; use the full cell holding (10 mL - 35 mL) and 1500 psi pressure.<br/>Collect and reintroduce into french press 1x.<br/>Heat denature at 70°C for about 15 mins.<br/>Spin down, 10,000 x g for 30 mins.<br/>Syringe filter the supernatant (0.22 µm filter).<br/>Proceed to IMAC purifications.

Immobilized metal ion affinity chromatography (IMAC) purification

Note: Save portions at each step for protein gel

Prepare a 1 mL Ni-NTA resin column.<br/>Saturate column with 5x the column volume (so 5 mL) of lysis buffer. Repeat this step twice.<br/>Bind with 1:1 lysis buffer:SN sample.<br/>Wash with 1x column volume of lysis buffer.<br/>Wash with 5x (column volume) of wash buffer.<br/>Elute with 3 mL of elution buffer and collect all 3 mL of elution.

Dialysis:

Place dialysis cassette into storage buffer for 2 mins.<br/>Remove top and load dialysis cassette with enzyme sample using a pipette or syringe.<br/>Squeeze the membrane to remove excess air.<br/>Replace top and place in beaker with 500 mL or 1 L of storage buffer. This should be done in the cold room on a stir plate.<br/>Allow to sit for 2 to 4 hours.<br/>Remove cassette and place in beaker with fresh storage buffer. Allow to sit overnight.<br/>If cassette has swollen, use syringe to remove some of the sample.<br/>Open top of cassette and remove sample.<br/>Store at –20°C.

Assay purified phusion polymerase activity by PCR

*IMPORTANT: You must use commercial Phusion buffer (NEB Cat #B0518S) for your reactions. It is a proprietary formulation that gives MUCH better enzyme performance.

Template for this assay is the 6his-pfu-sso7d-pET28 plasmid encoding the phusion polymerase.<br/>To estimate the activity of your purified Phusion, create a dilution series of purified polymerase in water ranging from 1:200 to 1:10, and compare to NEB's stock.<br/>NEB stock is viscous; for an accurate comparison to the purified Phusion, ensure you are pipetting sufficient volumes to maintain accuracy.

Primer sequences (position with reference to sequence in file above):

Name Position Tm 5' - 3' Amplicon size w/ R1 (bp)<br/>Phusion F1 672-695 66.4 agttccataggatggcaagatcc 4044<br/>Phusion F2 2748-2770 66.5 tgataccgatgaaacgagagagg 1968<br/>Phusion F3 3759-3779 66.4 gagctgtcttcggtatcgtcg 957<br/>Phusion F4 4169-4190 66.7 aacattagtgcaggcagcttcc 547<br/>Phusion R1 4694-4716 67.8 cctaatgcaggagtcgcataagg NA

Protocol:

Reagent Volume/ul<br/>Water 12.4<br/>dNTP (10mM) 0.4<br/>5x buffer 4<br/>Primer F (10uM) 1<br/>Primer R (10uM) 1<br/>Template (2ng/ul) 1<br/>Diluted Phusion 0.2

Conditions (Denaturation-Annealing-Extension repeated 30x):

Cycle Temperature Duration (secs)<br/>Initial denaturation 98 30s<br/>Denaturation 98 10s<br/>Annealing 69 20s<br/>Extension 72 30s / kbp<br/>Final extension 72 5m

Sample results for 2kbp amplicon:

Lane 1 2 3 4 5<br/>Phusion dilution 25 50 100 NEB (neat) H20

Limitations of purified polymerase

To date, we have noted reduced processitivity of longer transcripts (>4kb) using our purified polymerase compared to the commercial variant.

[7kb_4kb.pdf]

== Pfu Buffer ==

10 mM KCl

10 mM (NH4)2SO4

20 mM Tris-HCl, pH 8.8

2 mM MgSO4

0.1% Triton X-100

100 ug/ml BSA

'''Herculase PCR Buffer'''

50 mM Tricine, pH 9.1

8 mM (NH4)2SO4

2.3 mM MgCl2

0.1% Tween-20

75 ug/ml BSA

For PCR, add 2 U of Pfu dUTPase, 5 U Pfu/Phusion

'''Taq Buffer'''

10 mM Tris-HCl (pH 8.8)

50 mM KCl

2 mM MgCl2

0.1% Triton&nbsp;X-100



'''Buffer from websites'''

<span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">1. 10X Taq Buffer with KCl</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">100mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">500mM KCl,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">0.8% Nonidet P40.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">2. 10X Taq Buffer with KCl and 15mM MgCl2</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">100mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">500mM KCl,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">0.8% Nonidet P40,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">15mM MgCl2.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">3. 10X Taq Buffers with KCl Set</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">100mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">500mM KCl,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">0.8% Nonidet P40,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">MgCl2 different in each buffer (12.5-30mM)</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">4. 10X Taq Buffer with (NH4)2SO4</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">750mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">200mM (NH4)2SO4,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">0.1% Tween 20.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">5. 10X Taq Buffer with (NH4)2SO4 and 20mM MgCl2</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">750mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">200mM (NH4)2SO4,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">0.1% Tween 20,</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">20mM MgCl2.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">6. 10X Taq Buffer without Detergent</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">100mM Tris-HCl (pH 8.8 at 25 °C),</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">500mM KCl.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">7. 10X Pfu Buffer with 20mM MgSO4</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">200mM Tris-HCl (pH 8.8 at 25 °C), 100mM (NH4)2SO4, 100mM KCl, 1% (v/v) Triton X-100, 1mg/ml BSA and 20mM MgSO4.</span><br/><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">8. 10X Pfu Buffer</span><br/><span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;">200mM Tris-HCl (pH 8.8 at 25 °C), 100mM (NH4)2SO4, 100mM KCl, 1% (v/v) Triton X-100, 1mg/ml BSA.</span><span style="font-family: Arial, Helvetica, sans-serif; font-size: 14px;"></span>

<span style="color: rgb(0, 0, 0); font-family: arial, sans-serif; font-size: 15.2px;"></span><span style="font-family: Arial, Helvetica, sans-serif; font-size: 14px;"></span>



References

1. Wang, Y., Prosen, D. E., Mei, L., Sullivan, J. C., Finney, M., Vander Horn, P. B. (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro.&nbsp;Nucleic Acids Res.&nbsp;32: 1197–1207.&nbsp;«PubMedCentral»