Editing RPA

exo, fpg, nfo<br/><br/>The lyophilisate contains the polymerase system, including dNTPs, adenosine-50 -triphosphate,&nbsp;phospho-creatine, the mecA specific primers and detection probe, creatine kinase, '''S. aureus DNA polymerase I''' and components of&nbsp;a bacteriophage derived recombination system consisting of the&nbsp;proteins '''gp32''' ('''single-stranded DNA binding protein'''), '''uvsX&nbsp;'''('''recombinase''') and the '''uvsY (recombinase load factor)'''. The&nbsp;probe molecule contains three functional groups: the fluorophore&nbsp;fluorescein, the quencher BHQ1 and an abasic site mimic&nbsp;(tetrahydrofuran). The latter is a substrate for the enzyme&nbsp;'''exonuclease III''', which is present in the reaction. Detection is&nbsp;enabled by cleavage of the probe in a double-stranded DNA after&nbsp;recognition of the amplification material by the probe sequence.





'''Rad51 RecT''' or '''RecO''' Naturally, any derivatives and functional analogs of the recombinase agent above may also function itself as a recombinase agent and these derivatives and analogs are also contemplated as embodiments of the invention. For example, a small peptide from recA which has been shown to retain some aspects of the recombination properties of recA may be used. This peptide comprise residues 193 to 212 of E. coli. recA and can mediate pairing of ssoligos (Oleg N. Voloshin, Lijang Wang, R. Daniel Camerini-Otero, Homologous DNA pairing Promoted by a 20-amino Acid Peptide Derived from RecA. Science Vol. 272 10 May 1996).

Since the use of ATPγS results in the formation of stable Recombinase-agent/dsDNA complexes that are likely incompatible with efficient amplification, it is preferable to use ATP and auxiliary enzymes to load and maintain the Recombinase-agent/ssDNA primer complexes. Alternatively, the limitations of the use of ATPγS may be overcome by the use of additional reaction components capable of stripping recA bound to ATPγS from exchange complexes. This role might be played by helicases such as the RuvA/RuvB complex.

Auxiliary enzymes include several polymerases that can displace RecA in the 3′ to 5′ direction and can stimulate 3′ to 5′ disassembly of Recombinase-agent/dsDNA complexes (Pham et al., 2001). These DNA polymerase include '''E. coli PolV''' and homologous polymerase of other species. Normally in the life of E. coli, displacement of RecA in the 3′ to 5′ direction occurs as part of SOS-lesion-targeted synthesis in concert with SSB, sliding clamps and DNA polymerase. The polymerase essential for this activity in E. coli is PolV, a member of the recently discovered superfamily of polymerases including'''UmuC, DinB, Rad30 and Rev1''', whose function in vivo is to copy DNA lesion templates. Critical to RPA, the in vitro 3′ to 5′ disassembly of RecA filaments cannot be catalyzed by PolI, PolIII or PolIV alone. '''Only PolV, in concert with SSB, has measurable ATP-independent 3′ to 5′ RecA/dsDNA disassembly activity.''' In effect, PolV pushes and removes RecA from DNA in a 3′ to 5′ direction ahead of the polymerase (Pham et al., 2001; Tang et al., 2000). Inclusion of PolV or a functional homologue may improve the amplification efficiency.

Other auxiliary enzymes include a class of enzymes called helicases which can be used to promote the disassembly of RecA from dsDNA. These promote disassembly in both the 5′ to 3′ and 3′ to 5′ directions. Helicases are essential components of the recombination process in vivo and function to move the branch points of recombination intermediates from one place to another, to separate strands, and to disassemble and recycle components bound to DNA. After the first round of invasion/synthesis has occurred in RPA, two new DNA duplexes are “marked” by the presence of RecA bound over the site to which primers must bind for additional rounds of synthesis. In such a situation dsDNA tends to occupy the high affinity site in RecA until it is actively displaced, either by ATP-dependent dissociation in the 5′ to 3′ direction, which may be limiting, or by 3′ to 5′ dissociation by some other active process. An ideal helicase complex for stimulating disassembly of RecA from intermediates consists of the E. coli proteins RuvA and RuvB. The RuvAB complex promotes branch migration, and dissociates the RecA protein, allowing RecA to be recycled (Adams et al., 1994). Normally, the RuvAB complex is targeted to recombination intermediates, particularly Holliday junction-like structures. As it works the RuvAB complex encircles DNA and forces RecA from the DNA in an ATP-driven translocation (Cromie and Leach, 2000; Eggleston and West, 2000). This RecA dissociation activity has been demonstrated using supercoiled dsDNA bound with RecA, which does not even possess Holliday junctions (Adams et al., PNAS 1994). The RuvAB complex can recognize branched structures within the RecA coated DNA. Incorporation of RuvAB into the RPA mixture will promote the dissociation of RecA from dsDNA following strand exchange and displacement, allowing renewed synthesis of the duplicated template from the same site. Additionally, the RuvAB complex can act in concert with RuvC, which finally cuts and resolves Holliday junctions. With RuvC added to the RPA reaction mixture, complicated structures such as Holliday junctions formed at invasion sites, can be resolved. Resolvase activity, such as that provided by RuvC, is particularly important when the targeting oligonucleotides are partially double-stranded. In such situations reverse branch migration can generate Holliday junctions, which can then be resolved by the RuvABC complex, to generate clean separated amplification products.

Still other auxiliary enzymes include the E. coli RecG protein. RecG can stimulate disassembly of branch structures. In vivo this protein functions to reverse replication forks at sites of DNA damage by unwinding both leading and lagging strands driving the replication fork back to generate a 4-way junction (Cox et al., 2000; Dillingham and Kowalczykowski, 2001; Singleton et al., 2001). In vivo such junctions function as substrates for strand switching to allow lesion bypass. In vitro RecG will bind to D-loops, and will lead to a decrease in D-loop structures by driving reverse branch migration. RecG prefers a junction with double-stranded elements on either side, hence partly double-stranded targeting oligonucleotides, homologous to the targeting site in both single-stranded and double-stranded regions, would be ideal. This would stimulate reverse branch migration and formation of a Holliday junction, which can be resolved by the RuvABC complex. In vivo RecG and RuvAB may compete to give different outcomes of recombination since branch migration will be driven in both directions (McGlynn and Lloyd, 1999; McGlynn et al., 2000). In both cases the proteins target junction DNA coated with RecA, and disassemble it in an active manner.

Other auxiliary enzymes useful in an RPA reaction mixture are those that allow continual generation of RecA nucleoprotein filaments in the presence of ATP and SSB. In order to allow removal of RecA at the appropriate moments, it is preferred to use ATP rather than ATPγS in an RPA reaction. Unfortunately RecA/ssDNA filaments formed with ATP spontaneously depolymerize in the 5′ to 3′ direction, and in the presence of SSB, as required here, repolymerization will not occur at significant rates. The solution to this problem is the use of the RecO, RecR and possibly RecF proteins. In the presence of SSB and ATP, RecA/ssDNA filaments dissociate (Bork et al., 2001; Webb et al., 1995; Webb et al., 1997; Webb et al., 1999). If RecA/ssDNA is incubated in the presence of RecO and RecR proteins this dissociation does not occur. Indeed the RecR protein remains associated with the filament and stabilizes the structure indefinitely. Even if ssDNA is bound by SSB, in the presence of RecR and RecO, filaments of RecA can reassemble displacing SSB. Thus it is possible to obviate the use of ATPγS, if necessary, by using ATP in the presence of RecO and RecR to maintain RecA/ssDNA filament integrity. The RecF protein interacts with the RecO and RecR system in a seemingly opposing manner. RecF competes with RecR tending to drive filament disassembly in vitro. It is likely that all three components in vivo function together to control the generation of invading structures, while limiting the extent of RecA coating of ssDNA. In another preferred embodiment, RecF is included in RPA reactions at an appropriate concentration to re-capitulate the dynamics of the in vivo processes. In addition, RecF may facilitate dissociation of RecA-coated intermediates after invasion has occurred.

As described, the use of ATP rather than ATPγS, and/or the use of displacing polymerases and helicases (e.g. the RuvA/RuvB complex), RecO, RecR and RecF should permit exponential amplification of double-stranded DNA by driving continual regeneration of targeting sites. This method, however, remains responsive to differences in initiation rate that might occur at the two opposing targeting sites. Such differences may lead to a decrease in amplification efficiency, and to the production of some single-stranded DNA. The PCR method largely avoids these complications because temperature cycling leads to coordinated synthesis from either side. In another embodiment, a situation analogous to the PCR condition just described may be induced by using temperature sensitive (ts) mutants of RecA that are non-functional at 42° C., but function at lower temperatures in the range 25 to 37° C. (Alexseyev et al., 1996; Hickson et al., 1981). In this case, synthesis from either end can be synchronized by periodic lowering to the permissive temperature and then raising the reaction to a temperature non-permissive for the mutant RecA protein function, but permissive for the other components. By performing RPA with tsRecA mutants in combination with cycling of reaction temperatures, the number of molecules of DNA produced can be controlled. While this will require some mechanism to provide temperature cycling, the temperatures are well below those that would require the use of thermophile-derived proteins. Indeed, a simple chemical-based or portable low-power temperature-cycling device may be sufficient to control such reaction cycles.

RPA, as all other present-day nucleic acid amplification methods, employs polymerases to generate copies of template nucleic acid molecules. It is a necessity of most nucleic acid polymerases that incorporation requires a free 3′-hydroxyl moiety on the terminal sugar of a short stretch of double-stranded nucleic acid adjacent to the site of new synthesis. This stretch of double-stranded nucleic acid is typically formed on a template by a short complementary sequence, called a primer, which serves as an initiation site for the polymerase synthesis reaction. In some cases a 3′ modification, such as a sulfydryl, may utilized to prime the synthesis reaction. The primer nucleic acid, which is base-paired with the template and extended by the polymerase, can be RNA or DNA. In vivo during genomic DNA replication, RNA primer sequences are synthesized de novo onto template DNA by primase enzymes. Typically, for in vitro reactions the primer is supplied as a short, often chemically synthesized, single-stranded DNA (or modified DNA or RNA), and is usually referred to as an oligonucleotide primer. The primer is often of a specific sequence, although random primers can also be used. The primer is targeted to complementary sequences by virtue of its specific base-pairing capacity. Formation of hybrids between the oligonucleotide primer and target nucleic acid are typically formed by incubation of the two in solution under conditions of salt, pH and temperature that allow spontaneous annealing.

RecA protein can be obtained from commercial sources. Alternatively it can be purified according to standard protocols e.g. (Cox et al., 1981; Kuramitsu et al., 1981). RecA homologues have been purified from thermophilic organisms including Thermococcus kodakaraensis (Rashid et al., 2001), Thermotoga maritima (Wetmur et al., 1994), Aquifex pyrophilus (Wetmur et al., 1994), Pyrococcus furiosus (Komori et al., 2000), Thermus aquaticus (Wetmur et al., 1994), Pyrobaculum islandicum (Spies et al., 2000), and Thermus thermophilus (Kato and Kuramitsu, 1993). RecA has also been purified from other prokaryotes e.g. Salmonella typhimurium (Pierre and Paoletti, 1983), Bacillus subtilis (Lovett and Roberts, 1985), Streptococcus pneumoniae (Steffen and Bryant, 2000), Bacteroides fragilis (Goodman et al., 1987), Proteus mirabilis (West et al., 1983), Rhizobium meliloti (Better and Helinski, 1983), Pseudomonas aeruginosa (Kurumizaka et al., 1994), from eukaryotes e.g. Saccharomyces cerevisiae (Heyer and Kolodner, 1989), Ustilago maydis (Bennett and Holloman, 2001), including vertebrates e.g. Human Rad51 (Baumann et al., 1997) and Xenopus laevis (Maeshima et al., 1996), as well as plants including broccoli (Tissier et al., 1995).

1) Sequence Targeting

RPA is initiated by targeting sequences using synthetic oligonucleotides coated with RecA, or a functional homologue. In order to permit exponential amplification two such synthetic oligonucleotides would be employed in a manner such that their free 3′-ends are orientated toward one another. Nucleoprotein filaments comprising these oligonucleotides and RecA protein will identify targets in complex DNA rapidly and specifically. Once targeted the RecA protein catalyses strand exchange such that D-loop structures are formed. It may be necessary to use ATP rather than ATPγS in the procedure for efficient amplification. If ATP is used, RecO, RecR, and/or RecF, molecules may prove essential for efficient amplification.

2) Initiation of DNA Synthesis

DNA polymerases will detect and bind to the hybrid between the invading oligonucleotides and the template DNA and initiate DNA synthesis from the free 3′-hydroxyl exposed in the hybrid. Exposure of this 3′-hydroxyl, and subsequent DNA synthesis, will likely require disassembly of RecA protein from the double-stranded hybrid formed by strand exchange. To attain this disassembly it will probably be necessary to employ ATP, which can support spontaneous disassembly of RecA from invasion complexes. Additionally disassembly can be stimulated/enhanced by the use of other proteins contained within the reaction mixture such as RuvA, RuvB, RuvC, recG, other helicases, or other stimulatory components, which can act to strip RecA from the strand exchange product.

3) Strand Displacement DNA Synthesis and Replicon Separation.

As the DNA polymerases synthesize complementary copies of template DNAs using the free 3′-hydroxyls of invading oligonucleotides, or their partly extended products, the polymerases displace single-stranded DNAs, which may be coated with single strand binding proteins (SSB) included in the reaction. In an ideal configuration, invasion of oligonucleotides at both ends of the target nucleic acid sequence will occur in similar timeframes, such that two polymerases on the same template nucleic acid will initially progress toward one another. When these extending complexes meet one another, the original template should simply fall apart, and the polymerases will continue to synthesize without a need for strand displacement, now copying SSB-bound ssDNA template. Because of steric hinderance, polymerases may become dissociated from the template temporarily when the polymerases meet to permit the separation of the two template strands

4) Completion of Synthesis and Re-Invasion.

Once the template strands have separated, polymerases can complete the extension to the end of the template (or past the sequence acting as the second, facing, targeting site if the initial template is longer than the desired product). To permit exponential amplification it is necessary for new products to be targeted and replicated in a manner similar to the original templates, that is from both targeted ends. The newly synthesized targeted site will be freely available to targeting RecA/oligonucleotide filaments. The site initially used to prime synthesis should also have been freed as a consequence of the use of conditions in the reaction that favor disassembly of RecA from strand exchange products. Providing the re-invasion at this latter site occurs in less time than it takes the polymerase to synthesize past the second targeting site, be primed at that second site, and return to the first site, then single-stranded DNA will not be the primary product and exponential amplification will occur. Having multiple synthetic complexes operating on the same template raises the possibility that very short amplification times can be achieved.

1) Sequence Targeting

RPA is initiated by targeting sequences using synthetic oligonucleotides coated with RecA, or a functional homologue. Such nucleoprotein filaments will identify targets in complex DNA rapidly and specifically. Once targeted, the RecA protein catalyses strand exchange such that a D-loop structure is formed. It may be necessary to use ATP rather than ATPγS in the procedure for efficient amplification. The linkage of leading and lagging strand syntheses however may obviate the requirement for very rapid RecA stripping after initiation of synthesis. If ATP is used, RecO, RecR, and RecF molecules may prove essential for efficient amplification.

2) Primosome Assembly

Primosomes can be assembled at D-loops. Normally, D-loop structures are formed by RecA as part of the mechanism to rescue damaged DNA in vivo, or during other forms of recombination. The purpose of the combined action of RecA-mediated strand exchange and primosome assembly is to generate a replication fork. A replication fork is the nucleoprotein structure comprising the separated template DNA strands and the replisome. The replisome consists of the polymerase holoenzyme complex, the primosome, and other components needed to simultaneously replicate both strands of template DNA. Primosomes provide both the DNA unwinding and the Okazaki fragment priming functions required for replication fork progression.

Primosome assembly has been studied intensively through genetic and biochemical analysis in E. coli. The minimal set of polypeptides required for this process is well known and exist as purified components. The primosome assembly proteins are PriA, PriB, PriC, DnaT, DnaC, DnaB and DnaG. These proteins have been shown sufficient to assemble a primosome complex on bacteriophage ΦX74 DNA in vitro (Kornberg and Baker, 1992; Marians, 1992). PriA binds to the primosome assembly site (PAS) on the ΦX174 chromosome. Then PriB, DnaT, and PriC bind sequentially to the PriA-DNA complex. PriB appears to stabilize PriA at the PAS and facilitate the binding of DnaT (Liu et al., 1996). PriC is only partially required for the full assembly reaction. Omission of PriC from the reaction will lower priming 3 to 4 fold (Ng and Marians, 1996a; Ng and Marians, 1996b). The function of PriC in the bacterium is genetically redundant to PriB. DnaC then loads DnaB into the complex in an ATP-dependent fashion. This PriABC-DnaBT complex is competent to translocate along the chromosome. The DnaG primase can interact transiently with the complex to synthesize RNA primers.

During replication in E. coli, DnaB and DnaG function as a helicase and primase respectively. These two components are continually required in association with the PolIII holoenzyme to synthesize primers for the Okazaki fragments. Hence, DnaB and DnaG are the core components of the mobile primosome associated with the replication fork. The other primosome components described are essential for assembly of the primosome onto DNA, and for associating a dimeric polymerase. The primosome assembly proteins are required for the re-establishment of replication forks at recombination intermediates formed by RecA and strand exchange. PriA can initiate assembly of a replisome, competent for DNA synthesis, on recombination intermediates. It is possible to target D-loops in vitro with a mixture of PriA, PriB and DnaT, which are then competent to incorporate DnaB and DnaC. Once a primosome has been formed at the D-loop, all that remains to initiate replication is to load a holoenzyme complex to the site.

3) Fork Assembly and Initiation of DNA Synthesis

Replication forks will assemble at the site of primosome assembly. The presence of a free 3′-end on the invading strand of the D-loop stimulates the DnaX clamp loader complex detailed earlier to assemble a β-dimer at this site to act as a sliding clamp. The holoenzyme and 2 core units are joined together by the scaffold τ subunit. The τ subunit also has interaction surfaces for the β-dimer, for the clamp loader, and for the DnaB helicase component of the primosome. These multiple interactions are necessary to coordinate synthesis of both leading and lagging strands using the 2 asymmetrically joined core polymerase complexes.

The primosomal primase, DnaG, synthesizes a short RNA primer onto the unwound lagging strand DNA template. In the presence of the holoenzyme, the clamp loader recognizes the RNA/DNA duplex and loads a second β-dimer clamp onto this site. The presence of an active primosome and the interaction of the τ subunit with DnaB are critical to ensure simultaneous leading/lagging strand synthesis. Without this interaction the polymerase will move away from the primosome site without coupling.

A replication fork is now assembled. Synthesis of both leading and lagging strand will now occur simultaneously, and the DnaB helicase will separate template strands ahead of the oncoming holoenzyme. The lagging strand holoenzyme core will generate Okazaki fragments of 1 to 2 kilobases in length. Once the lagging strand polymerase encounters the previous RNA primer, it dissociates from the β-clamp and synthesis is initiated from a newly assembled clamp loaded in the vicinity of the front of the leading strand. The same lagging strand holoenzyme core will be re-used since it is physically tethered to leading strand core.

There is a dynamic interaction between β-dimer clamps, core subunits and clamp loaders. Their affinities can switch depending upon the physical circumstances. The β-dimer that has been ‘abandoned’ at the end of the Okazaki fragments may be recycled via active removal by clamp loaders, or excess δ subunit that may be present.

The RNA primers at the ends of Okazaki fragments are removed by the 5′ to 3′ exonuclease activity of DNA polymerase I. DNA ligase then joins the Okazaki fragments together forming a continuous lagging strand.

4) Fork Meeting and Termination

In RPA, replication is initiated at two distant sites and the replication forks are oriented toward each other. As replication forks converge the two original template strands will dissociate from one another as they become separated entirely both behind, and in front, of each fork. The leading strand core of each fork will then complete synthesis, the remaining RNA primers will be processed, and the final products will be two double-stranded molecules. We can reasonably expect to amplify DNA's on the order of several Megabases (Mb) by such an approach. In this disclosure, megabase also encompasses megabasepairs. Based on the known synthetic rate of the PolIII holoenzyme we can expect the replication forks to proceed at a rate of approximately 1 Mb/1000 seconds, i.e., approximately 15 to 20 minutes per cycle for a 1 Mb fragment.

The final consideration is the mechanism by which rapid exponential amplification of DNA will be achieved. The key to this process will be to allow efficient reinvasion of the targeting sites by the use of mixtures of helicases, resolvases and the RecO, RecR, and RecF proteins. Under appropriate conditions reinvasion and primosome assembly should be possible shortly after a holoenzyme has moved away from the fork-assembly site. Continual invasions should present no problems since the DNA will simply become branched at many points. Each branch will naturally resolve as it encounters the oncoming fork. Under these conditions it may be possible to achieve enormous amplification in times similar to the time taken to replicate the DNA only once. It may be critical however to limit the concentrations of targeting oligonucleotides to avoid nucleotide depletion prior to the completion of synthesis.

In addition to the holoenzyme complex, the replication machine employs another complex known as the primosome, which synthesizes the lagging strand and moves the replication fork forwards. The primosome complex comprises a helicase encoded by DnaB and a primase encoded by DnaG. Finally, in addition to the proteins of the holoenzyme and primosome, replication requires the activity of single-stranded DNA binding protein (SSB), E. coli DNA polymerase I and DNA ligase. These latter two components are required to process Okazaki fragments.

Nested RPA:

In another embodiment, RPA amplification may be performed in a process referred to herein as “nested RPA.”

A difficulty in detecting a rare sequence is that there can be a high ratio of non-target to target sequence. The ability of a RPA to discriminate between target and non-target DNA and amplify only target sequences is a key aspect of improved sensitivity. Discrimination between non-target and target is a reflection of the specificity of the primers and reaction conditions. The more specific a reaction is the greater the relative amount of the specific target sequence that is produced and the easier that product is to detect. An increase in specificity can, therefore, increase sensitivity as well.

The need for improved sensitivity and specificity can be addressed by using nested RPA. The nested RPA involves a first RPA of a first region of DNA. Then the reaction mixture is diluted, for example, by 10, 20, 30, 40, 50, 75, or 100 fold or more to reduce the concentration of the first primer pair, and a second primer pair is introduced into the reaction mixture and RPA repeated. According to one embodiment of the invention, the second primer pair is designed to be internal to the first primer pair to amplify a subsequence of the first RPA product. The method increases specific amplification, i.e., reduces non-specific background amplification products and therefore increases sensitivity. Such non-specific amplification products, although they arise by virtue of fortuitous partial homology to the flanking primers, are unlikely to also have sufficient homology to the nested primers to continue to amplify. Detection and specificity of RPA may be further improved by labeling one or both of the second primer pair such that only primers amplified with one or both of the second primer pair is detected.

Formation of nucleoprotein filaments can be performed by incubation of the primer (oligonucleotides) with RecA protein or its homologues in the presence of ATP, and auxiliary proteins such as RecO, RecR and RecF. When incubated at 37° C. in RecA buffer (20 mM Tris-HCl pH 7.5, 10 M MgCl2, 2 mM ATP, 2 mM DTT and 100 ug/ml Bovine Serum Albumin), RecA will form helical filaments on ssDNA with 6 protomers per turn. The DNA is located within the interior of the protein helix. In the presence of dsDNA, the RecA/ssDNA nucleoprotein filament can scan DNA at rates of at least 107 bp per hour. The mode of scanning is unclear but it is at a speed (>103 bp per second) that it may involve only the initial few base pairs that can be easily accessed along one face of the major groove. Successful binding may result in a transition to a triple-helical intermediate, which is then followed by strand invasion and displacement to form a D-loop. Such joint molecules can be formed under similar condition to those described above for formation of helical filaments, and hence in the presence of ssDNA, the homologous dsDNA, RecA, ATP, auxiliary proteins and suitable buffer and temperature conditions, joint molecules will form spontaneously. If ATP is used the assembly is reversible and will reach equilibrium, but RecA/ssDNA filaments can be stabilized, even in the presence of SSB, by the auxiliary proteins RecO and RecR. In the case of thermostable proteins the temperature of incubation can be higher. If a renewable supply of ATP is required a standard ATP regeneration system can be included in the reaction.

DNA polymerases can use the free 3′-hydroxyl of the invading strand to catalyze DNA synthesis by incorporation of new nucleotides. A number of polymerases can use the 3′-hydroxyl of the invading strand to catalyze synthesis and simultaneously displace the other strand as synthesis occurs. For example E. coli polymerase II or III can be used to extend invaded D-loops (Morel et al., 1997). In addition, E. coli polymerase V normally used in SOS-lesion-targeted mutations in E. coli can be used (Pham et al., 2001). All of these polymerases can be rendered highly processive through their interactions and co-operation with the β-dimer clamp, as well as single stranded DNA binding protein (SSB) and other components. Other polymerases from prokaryotes, viruses, and eukaryotes can also be used to extend the invading strand.

The recombinase agent of the invention may be RecA, RadA, RadB, Rad 51 or a functional analog or homologues of these proteins.

For example, both eukaryotic and prokaryotic polymerases can be used. Prokaryotic polymerase include, at least, E. coli pol I, E. coli pol II, E. coli pol III, E. coli pol IV and E. coli polV. Eukaryotic polymerase include, for example, multiprotein polymerase complexes selected from the group consisting of pol-α, pol-β, pol-δ, and pol-ε.

In another embodiment of the invention, the RPA process is performed in the presence of an accessory component to improve polymerase processivity or fidelity. Both eukaryotic and prokaryotic accessory components may be used. Preferably, the accessory component is an accessory protein is from E. coli. Useful accessory proteins include single-strand binding protein, helicase, topoisomerase and resolvase. Other useful accessory proteins include a sliding clamp selected from the group consisting of an E. coli β-dimer sliding clamp, an eukaryotic PCNA sliding clamp and a T4 sliding clamp gp45. Other accessory components include a DNA Polymerase III holoenzyme complex consisting of β-Clamp, DnaX Clamp Loader, and the Polymerase Core Complex. Still other accessory component include RuvA, RuvB, RuvC and RecG. The properties endowed by the use of additional components will likely enable the amplification of large DNAs not previously successfully targeted by current methods such as PCR.

In another embodiment, the RPA is performed in the presence of agents used to stabilize a RecA/ssDNA nucleoprotein filaments. For example, the agent may be RecR, RecO, RecF or a combination of these proteins. Other useful agents include PriA, PriB, DnaT, DnaB, DnaC, and DnaG.

<br/>Leading Strand Recombinase-Polymerase Amplification (lsRPA) DNA sequences can be amplified using leading strand synthesis according to the Recombinase-Polymerase amplification (RPA) method depicted in FIG. 1.

A reaction is assembled with the following composition:

<br/>D-LOOP FORMATION/RESOLUTION COMPONENTS: Component Concentration RecA 20 μM Single-stranded oligonucleotide primer 0.25 μM ATP 3 mM RecF 0.1 μM RecO 0.13 μM RecR 0.5 μM Single-stranded Binding protein (SSB) 1 to 10 μM DNA polymerase V 5 units

POLYMERASE/HELICASE/RESOLVASE MIX: Component Concentration DNA Polymerase 5 units RuvA 0.5 μM RuvB 0.5 μM RuvC 0.5 μM RecG 10 nM

REACTION BUFFER: Component Concentration MgCl2 2 to 10 mM TrisHCl pH 7.2 10 mM DTT 0 to 10 mM KCl 0 to 50 mM Deoxyribonueleotide triphosphates 0.2 mM Bovine serum albumin (BSA) 0 to 10 μg per ml The reaction is assembled so that the final concentration satisfies the D-Loop Formation/Resolution Components, Polymerase/Helicase/Resolvase Mix, and Reaction Buffer with the DNA polymerase and/or template added last if necessary. For example, a 2× concentrated solution of D-Loop Formation/Resolution Components and of the Polymerase/Helicase/Resolvase Mix may be made in 1× reaction buffer. The reaction may be initiated by mixing an equal volume of each of the two components (each in 1× reaction buffer). Optionally, and as stated above, the DNA polymerase or template (target DNA) may be added last. The reaction is incubated for a sufficient time of until the reactants are exhausted. Typical incubation times would range from 1 hour, 2 hours, 3 hours, 5 hours, 10 hours or overnight (about 16 hours). Unlike PCR, which requires small volumes for rapid temperature change, there is no limit to the reaction volume of RPA. Reaction volumes of 25 ul, 50 ul, 100 ul, 1 ml, 10 ml and 100 ml or larger may be performed in one vessel. Incubation temperature may be typical laboratory temperatures such as 25° C., 30° C. or 37° C.

Prior to the addition of template DNA and/or Polymerase, RecA and SSB will compete for binding to single-stranded oligonucleotide primers. In the presence of a RecR and RecO, RecA is selectively stabilized onto the single-stranded primers forming RecA nucleoprotein filaments in a complex with RecO and RecR. This complex is competent to invade double-stranded DNA to form a D-loop at sites homologous to the oligonucleotide primers. Alternatively, RecA, RecO and RecR can be pre-loaded onto oligonucleotide primers prior to the introduction of SSB to the reaction mixture (FIG. 1). The invading strands will be extended by the polymerase in a 5′ to 3′ direction. As D-loops are formed and synthesis proceeds displaced single stranded DNA becomes coated with SSB. RecA release from double-stranded DNA can occur via ATP hydrolysis in a 5′ to 3′ direction or as a result of helicase/resolvase or polymerase activity (FIG. 2A, B). New rounds of invasion/synthesis will continuously occur. The third round of strand-invasion/synthesis will release discrete products released whose ends correspond to the two facing primer sites. These fragments will soon become the dominant reaction product and will accumulate to high levels. As each synthetic complex processes to the end of the template RecA protein is displaced either by polymerase activity or by the activity of helicases, such as RuvAB or resolvases, such as RuvC. Once primers, ATP, deoxynucleoside triphosphates, or any other limiting component is exhausted, the reaction will stop.

The inclusion of temperature-sensitive RecA mutants will allow the controlled initiation of DNA synthesis. In such a situation, the initiation reaction is performed at 25 to 37° C. permitting the formation of D-loops. Elongation reactions are performed at 42° C., which is non-permissive for RecA mediated double-strand invasion. The number of cycles will determine the amount of reaction product. Extended elongation phases will permit the amplification of extremely long DNAs without interference of re-invasion.

Example 2 Nested RPA The RPA reaction is performed as described in Example 1. A fraction of one tenth ( 1/10) and one hundredth ( 1/100) of the reaction is removed and used in place of the DNA template in a second round of RPA. IsRPA, leading/lagging RPA, and combinations thereof may be used for nested RPA.

Example 3 Simultaneous Leading And Lagging Strand Recombinase-Polymerase Amplification DNA sequences can be amplified using simultaneous leading and lagging strand synthesis according to the Recombinase-Polymerase amplification (RPA) method depicted in FIG. 2.

A reaction is assembled with the following composition:

<br/>D-LOOP FORMATION/RESOLUTION COMPONENTS Component Concentration RecA 20 μM Single-stranded oligonucleotide primer 0.25 μM ATP 3 mM RecF 0.1 μM RecO 0.13 μM RecR 0.5 μM Single-stranded Binding protein (SSB) 1 to 10 μM DNA polymerase V 5 units

HELICASE/RESOLVASE MIX Component Concentration RuvA 0.5 μM RuvB 0.5 μM RuvC 0.5 μM RecG 10 nM

PRIMOSOME COMPLEX Component Concentration PriA  20 nM PriB  20 nM DnaT 100 nM DnaB 100 nM DnaC 200 nM DnaG 200 nM

DNA POLYMERASE III HOLOENZYME COMPLEX Component Concentration β-Clamp 2 μM DnaX Clamp Loader 500 nM Polymerase Core Complex 500 nM

LAGGING STRAND MIX Component Concentration DNA polymerase I 5 units DNA ligase 2 units

REACTION BUFFER Component Concentration MgCl2 2 to 10 mM TrisHCl pH 7.2 10 to 20 mM DTT 0 to 10 mM KCl 0 to 50 mM Deoxyribonucleotide triphosphates 0.2 to 0.4 mM Bovine serum albumin (BSA) 0 to 10 μg per ml The reaction is assembled so that the final concentration of all the reagents is as listed above. Thus, for example, a 5 fold concentrated solution of each of the components (D-loop Formation/Resolution Components, Helicase/Resolvase Mix, Primosome Complex, DNA Polymerase III holoenzyme Complex, Lagging Strand Mix) is made in 1× reaction buffer. Then, the five solutions are mixed together in equal volumes to initiate the reaction. The reaction is incubated for a sufficient time of until the reactants are exhausted. Typical incubation times would range from 1 hour, 2 hours, 3 hours, 5 hours, 10 hours or overnight (about 16 hours). As stated above, there is no limit to the reaction volume of RPA. Reaction volumes of 25 ul, 50 ul, 100 ul, 1 ml, 10 ml and 100 ml or larger may be performed in one vessel. Incubation temperature may be typical laboratory temperatures such as 25° C., 30° C. or 37° C.

First, the primosome loads onto the D-loop formed by RecA nucleoprotein filament invasion. The primosome synthesizes a stretch of RNA primer. Finally, primosome recruits the clamp loader, which recruits both the sliding clamp dimer and the asymmetric DNA polymerase core (FIG. 3A).

Synthesis occurs simultaneously in both the leading and lagging directions. Eventually lagging strand synthesis stops and the lagging strand clamp is unloaded. Synthesis of the leading strand continues until a new site of lagging stand synthesis is formed (FIG. 3B).

While leading strand synthesis continues, a new site of lagging stand synthesis is formed. Lagging strand synthesis continues back to the previous Okazaki fragment where the lagging strand clamp is unloaded (FIG. 3C).

DNA Polymerase I removes the RNA primer, and fills in the gap while DNA ligase connects the two Okazaki fragments forming a continuous lagging strand



The kit (TwistAmpTM Basic) from TwistDc for RPA amplification<br/>provides the uvsX recombinase, uvsY, gp32 single-strand DNA<br/>binding protein, Sau polymerase, ATP and dNTP. In the RPA, at least<br/>'''30 bp-long''' primers are required to allow the recombinase to bind<br/>to. Therefore, conventional PCR primers cannot be used in the RPA<br/>DNA amplification. Extended primers were designed and used in<br/>this study (Table 1). After DNA amplification, amplicons were<br/>sequenced and the results showed perfect concordance with the<br/>sequence of the aptamer.<br/>Mg 2+ ion is a critical factor to initial DNA amplification in the<br/>RPA and its concentration is correlated to the rate of reaction.<br/>Although more Mg 2+ added increases the amplification rate,<br/>excess amount of Mg 2+ causes non-specific amplification. Mg 2+<br/>of 12 mM was found to be the optimal concentration to generate<br/>results with the highest signal-to-noise ratio

For the real-time RPA assay, the amount of aptamer so gene-<br/>rated by RPA against time was reported by the fluorescence of<br/>EvaGreen DNA binding dye. The following formula was used for<br/>signal normalization: [Sample Fluorescence—Control Fluorescence]/<br/>[Baseline Fluorescence]. Baseline fluorescence was recorded at the<br/>first 5 min in the real-time the assay. The normalization step allows<br/>us to compare the results among assays.



== Designing assay examples ==

<span style="font-size:medium">1. U00735 </span>bovine coronavirus<span style="font-size:medium"></span>

GCTATAATGGTGCAATTAGATTTGACAGT<br/>gctataatggtgcaattagatttgacagtacactttcaggttttgagaccataatgaaggtgttgaat

for making probe<br/><span style="background-color:#DDA0DD">gagaatttgaatgcatatca </span><span style="background-color:#FF0000">acaacaagatggtatgatgaatatgagtcc</span>&nbsp;&nbsp;&nbsp; aaaaccacagcgtc<span style="background-color:#ADD8E6"></span>agc<br/>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; GAATATGAGTCC&nbsp;&nbsp;&nbsp; AAAACCACAGCGTCAGC<br/>probe TIB MOLBIOL (Berlin, Germany)<br/>5-GGACTCATATTCATCATACCATCTTGTTGT(BHQ1-dT)(THF)(FAM-dT)ATGCATTCAAATTCTC-Phosphate.


[[Category:Knowledgebase]]