Editing Ribosome Display

Production of Human Single-Chain Antibodies by Ribosome Display<br/>Mingyue He, Neil Cooley, Alison Jackson, and Michael J. Taussig

Antibody Engineering<br/>Methods and Protocols, 2004

page 177


<div>
2. Materials<br/>All the solutions, tubes, and tips used must be sterilized. Reagents should be nuclease-free. Precautions should be taken to avoid DNA contamination. It is recommended that solutions such as primers, RT-PCR buffer, washing buffer, and dNTPs should be stored at –20°C in aliquots.<br/>2.1. Primers<br/>2.2. Molecular Biology Kits and Reagents<br/>1. mRNA purification kit (Amersham Biosciences; Cat. #270-9255-01).<br/>2. TitanTM one tube RT-PCR system (Roche; Cat. #1888 382).<br/>3. TOPO TA cloning kit (Invitrogen; Cat. #K4500-01).<br/>4. Qiagen QIAEX II gel extraction kit (Qiagen; Cat. #20021).<br/>5. QIAquick PCR purification kit (Qiagen; Cat. #28104).<br/>6. TNT T7 quick for PCR DNA (Promega; Cat. #L5540).<br/>7. Expand HiFi DNA polymerase (ExpandTM high-fidelity PCR system: Roche; Cat. #1732 641).<br/>8. Taq DNA polymerase (Qiagen; Cat. #201203).<br/>9. AMV reverse transcriptase (Promega; Cat. #M5101).<br/>10. 25 mM dNTPs: mix equal volumes of each 100 mM dNTP stock solution (Amer- sham Biosciences).<br/>11. 100 mM DTT (TitanTM one tube RT-PCR system: see item 2).<br/>12. Tosyl-activated Dynabeads M-280, 6.7 × 108/mL or 10 mg/mL (Dynal Biotech; Cat. #142.03).<br/>13. Dynabeads M-280 streptavidin, 6.5 × 108/mL or 10 mg/mL (Dynal Biotech; Cat.#112.05/06).<br/>14. RNase-free DNase I (Roche; Cat. #776 785).<br/>15. Agarose.<br/>16. 0.5-mL siliconized RNase-free microfuge tubes (Ambion; Cat. #12350).<br/>17. Sterilized, diethylpyrocarbonate (DEPC)-treated distilled water (ddH2O): auto-claved Milli-Q water containing 0.1% (v/v) DEPC.

2.3. Solutions<br/>1. One-tube RT-PCR Solution 1 (per 100 μL): 100 mM DTT (from TitanTM kit)<br/>10 mM dNTPs<br/>Upstream primer (16 μM)<br/>Downstream primer (16 μM) ddH2O<br/>Store at –20°C.<br/>2. One-tube RT-PCR Solution 2 (per 96 μL): 5X RT-PCR buffer (from TitanTM kit) ddH2O<br/>Store at –20°C.<br/>10 μL 4 μL<br/>6 μL (see Tables 1–5)<br/>6 μL (see Tables 1–5) 74 μL<br/>40 μL 56 μL<br/>3. Buffer A: 0.1 M sodium phosphate buffer, pH 7.4.<br/>4. Buffer D: buffer A containing 0.1% bovine serum albumin (BSA).<br/>5. Buffer E: 0.2 M Tris-HCl, pH 8.5, containing 0.1% BSA.<br/>6. Phosphate-buffered saline (PBS): 1.63 mM Na2HPO4, 1.47 mM KH2PO4, 2.68 mM<br/>KCl, and 136 mM NaCl, pH 7.4.<br/>7. EZ-linkTM sulfo-NHS-LC-LC-biotin (Pierce; Cat. #21338). Solution is freshly<br/>made at a concentration of 1 mg/mL in water.<br/>8. Antigen solution (0.5–1 mg/mL) in PBS.<br/>9. 2X dilution buffer: PBS containing 10 mM magnesium acetate, stored at 4°C.<br/>10 Washing buffer: PBS containing 0.1% Tween 20 and 5 mM magnesium acetate, stored at 4°C.<br/>11. 10X DNase I digestion buffer: 400 mM Tris-HCl, pH 7.5, 60 mM MgCl2, 100 mM NaCl, autoclaved and stored at 4°C.<br/>12. 10% sodium azide.
</div><div><br/></div><div>3. Methods</div><div>3.1. Antibody Library Construction</div><div>Single-chain antibody libraries in the format of VH/K and VH/Vλ-Cκ (see Note 1) are constructed for ribosome display (Fig. 3). VH/K is generated by linking the heavy-chain variable domain (VH) to the complete κ chain. VH/Vλ-Cκ is made by linking VH to a fusion of variable region of λ chain (Vλ) and constant region of κ chain (Cκ). The heavy-chain “elbow” region, which is a continuation of the VH domain, is used as the peptide linker to join heavy chains with light chains (8,11). The use of the “elbow” as a linker simplifies the process of library construction and avoids the introduction of nonhuman sequences. A T7 promoter and Kozak sequence are placed upstream to allow protein synthesis in the rabbit reticulocyte lysate. To generate stable ribosome complex, the stop codon is removed from the DNA using a primer lacking the stop codon (7,8). The Cκ domain provides a spacer region to allow an antibody fragment to be displayed on the surface of ribosome and to offer priming sites for RT-PCR recovery after selection.</div><div><br/></div><div>1. Isolate total mRNA from human peripheral blood lymphocytes (PBLs) using the mRNA purification kit according to manufacturer’s instructions.</div><div>2. Generate individual VH-linker, κ, Vλ, and Cκ fragments by one-tube RT-PCR using the primers described under Subheading 2.1. Set up the one-tube RT-PCR mixture as follows:</div><div>Solution 1 (see Subheading 2.3.) 24 μL</div><div>Solution 2 (see Subheading 2.3.) 24 μL</div><div>Enzyme mix (from TitanTM kit) 1 μL (see Note 2)</div><div>mRNA1 μL (10–50 ng).</div><div><br/></div><div><br/></div><div>A negative RT-PCR control (10 μL) is also set up without adding mRNA. Carry out</div><div>RT-PCR thermal cycling: 1 cycle of 48°C for 45 min, followed by 94°C for 2 min; then 35 cycles of: 94°C for 30 s, 54°C for 1 min, 68°C for 2 min; finally, 1 cycle of 68°C for 7 min, then hold at 10°C.</div><div>3. Analyze 5–10 μL of the RT-PCR products by electrophoresis on a 1–2% agarose gel containing 0.5 μg/mL ethidium bromide. Purify individual DNA fragments of appropriate size (the expected size for VH is ~400 bp, κ light chain should be ~700 bp, and Vλ is ~350 bp) using the QIAEX II gel extraction kit.</div><div>4. Assemble the purified DNA fragments using PCR (see Fig. 3):</div><div>a. To generate the random assembly of different VH and light chains, individual fragments generated from family-specific primers (see Tables 1–3) are mixed in</div><div><br/></div><div>equal amounts to form pooled VH-linker fragments, pooled Vλ fragments, and</div><div>pooled κ chains.</div><div>b. VH/K is generated by PCR assembly of the VH-linker pool and κ chain pool</div><div>through the overlapping sequence between the two fragments.</div><div>c. VH/Vλ-Cκ is produced in two assembly steps: first, the Vλ pool is fused to Cκ to</div><div>form Vλ-Cκ, then Vλ-Cκ is fused to the VH-linker pool to produce VH/Vλ-Cκ.</div><div>5. Set up the reactions as follows:</div><div>DNA fragment 1 (see Fig. 3) 5–25 ng DNA fragment 2 (see Fig. 3) 5–25 ng 10X PCR buffer (from the Qiagen Taq kit) 2.5 μL</div><div>5 μL 1 μL 1 U</div><div>5X Q solution (from the Qiagen Taq kit) 2.5 mM dNTPs</div><div>Taq DNA polymerase</div><div>ddH2O to final volume</div><div>25 μL.</div><div>Carry out 8 cycles of 94°C for 1 min; 54°C for 1 min; 72°C for 1 min.</div><div>6. Add 2 μL of the previous reaction to the following mixture for PCR amplification:</div><div>10X PCR buffer</div><div>5X Q solution</div><div>2.5 mM dNTPs</div><div>16 μM of upstream primer 16 μM of downstream primer Taq DNA polymerase Distilled H2O to final volume</div><div>5 μL 10 μL 4 μL</div><div>1.5 μL 1.5 μL 2.5 U</div><div>48 μL.</div><div>Carry out 30 cycles of thermal cycling: 94°C for 30 s, 54°C for 1 min, 72°C for 1</div><div>min; finally, 1 cycle of 72°C for 7 min, then hold at 10°C.</div><div>7. Analyze the PCR products by agarose gel electrophoresis as described in step 3.</div><div>8. ConfirmintegrityoftheassemblyproductbyPCRmapping.ElutethePCRproduct</div><div>from the gel using the QIAEX II gel extraction kit and then carry out PCR using</div><div>combinations of primers, which allow diagnosis of product integrity (see Note 3).</div><div>9. Analyze diversity of the libraries by PCR cloning using the TOPO TA cloning kit, followed by DNA fingerprinting (14) and sequencing of individual clones (see</div><div>Note 4).</div><div>10. Store the libraries for subsequent selections (see Note 5).</div><div>3.2. Preparation of Antigen-Coupled Magnetic Beads</div><div>Antigen-coupled Dynabeads are used to capture specific ribosome com- plexes. Protein antigens can be linked either directly onto tosyl-activated Dyn- abeads or indirectly onto streptavidin Dynabeads through biotinylation.</div><div>3.2.1. Coupling of Antigen to Tosyl-Activated Dynabeads</div><div>1. Wash Dynabeads 3× with 0.5 mL of buffer A using a magnetic particle concentrator (Dynal MPC). A convenient amount to prepare is 0.5–1 mg (50–100 μL) of beads.</div><div>2. Mix the beads with antigen in proportions of 20 μg antigen: 1 mg beads (100 μL) and vortex for 1 min. Incubate at 37°C for 16–24 h with slow rotation</div><div>3. Remove the supernatant and wash the beads twice with 0.5 mL of buffer D at 4°C for 5 min, then treat with 0.5 mL of buffer E at 37°C for 4 h to block free tosyl groups.</div><div>4. Wash once with 0.5 mL of buffer D at 4°C for 5 min and resuspend in the original volume (100 μL, see step 2) in buffer D containing 0.02% sodium azide. The anti- gen-coupled beads are ready for use, and can be stored for 3–4 mo at 4°C.</div><div>3.2.2. Coupling of Biotinylated Proteins to Streptavidin Dynabeads</div><div>1. Mix antigen solution in PBS with sulfo-NHS-biotin solution (1 mg/mL) in propor- tions of 25 μg antigen: 1 μg sulfo-NHS-biotin. Incubate the mixture at room tem- perature for 30 min. Remove unreacted sulfo-NHS-biotin by dialysis against two 500-mL changes of PBS at 4°C overnight. The biotinylated protein can be stored at 4°C until use.</div><div>2. Wash 20 μL of streptavidin Dynabeads M-280 3× with buffer A as in Subheading 3.2.1., step 1 and resuspend in 20 μL of PBS. Add 2 μg of biotinylated protein to the streptavidin Dynabeads M-280 in the proportions of 10 μg biotinylated protein: 1 μg beads. Incubate the mixture at room temperature for 30 min. Remove the supernatant and wash beads 3× with 50 μL of PBS. Finally, resuspend in the origi- nal volume (20 μL) of buffer D containing 0.02% sodium azide. Beads may be stored at 4°C for 3–4 mo.</div><div>3.3. ARM Ribosome Display</div><div>The PCR libraries are expressed in a coupled rabbit reticulocyte lysate (TNT) system to generate ARM complexes. The amount of library needed for display depends on the antibody affinity to be selected: antibodies with higher affinity are more sensitively recovered, and thus require less input DNA. More DNA is required for low-affinity antibodies. Repeated cycles can enrich rare species from a library. The effective display size is determined by the number of active ribosomes which, in the TNT mix, are present at approx 1014/mL (supplier’s information). As 1 μg of 1 kb DNA contains 9.1 × 1011 molecules, up to 5 μg of PCR library can be used by the procedure described here. This system can be scaled up for a larger library display (see Note 6).</div><div>1. Set up in vitro coupled transcription/translation to generate ribosome complexes. The following is a standard 50-μL mixture:</div><div>TNT T7 Quick for PCR DNA 40 μL PCR DNA (from Subheading 3.1., step 7) up to 5 μg</div><div>1 mM methionine (from TNT kit) 100 mM magnesium acetate ddH2O</div><div>1 μL</div><div>0.5 μL (see Note 7) to 50 μL</div><div>Incubate at 30°C for 60 min.</div><div>2. DNase I digestion to remove the input PCR fragment: to the mixture, add 40 U of</div><div>DNase I together with 6 μL of 10X DNase I digestion buffer and ddH2O to a final volume of 60 μL. Incubate the mixture at 30°C for an additional 15 min.</div><div>3. Dilute the mixture with 60 μL of cold 2X dilution buffer.</div><div>4. Add 1–2 μL of antigen-linked beads to the mixture and incubate at 4°C for 1–2 h</div><div>with gentle shaking or vibration.</div><div>5. Wash the beads 5× with 100 μL of cold washing buffer, followed by two washes</div><div>with 100 μL of cold ddH2O.</div><div>6. Resuspend the selected beads in 10 μL of ddH2O for RT-PCR.</div><div>7. Carry out the in situ RT-PCR recovery as follows:</div><div>50 μL 48 μL</div><div>a. Set up the RT-PCR mixture: Solution 1 (see Subheading 2.3.) Solution 2 (see Subheading 2.3.) Enzyme mix</div><div>2 μL (see Note 2)</div><div>b. Dispense 10–20 μL of the previous mixture (see Note 8) into tubes for each</div><div>individual sample and then add 2 μL of the selected beads. Carry out thermal cycling as follows: 1 cycle of 48°C for 45 min, followed by 94°C for 2 min; then 30–40 cycles of 94°C for 30 s, 54°C for 1 min, and 68°C for 2 min; finally, 1 cycle of 68°C for 7 min, then hold at 10°C.</div><div>8. Analyze the RT-PCR products by agarose electrophoresis as described in step 3 (see Notes 9 and 10).</div><div>9. Recover the DNA fragments from the agarose gel using Qiagen gel extraction kit and re-amplify the DNA product by PCR for further manipulations such as repeat- ing the display cycle or cloning and E. coli expression (see Note 11).</div><div>4. Notes</div><div>1. Although only the formats VH/K and VH/Vλ-Cκ are described in this chapter, the method is in principle equally applicable to other forms of single-chain antibodies, provided that a spacer domain is present at the C-terminus. The spacer should con- tain at least 30 amino acid residues to allow the VH/VL domain to be exposed on the ribosome surface.</div><div>2. The one tube RT-PCR can be carried out with comparable efficiency using AMV reverse transcriptase and Expand HiFi DNA polymerase in combination with the TitanTM RT-PCR buffer. For example, to a 50-μL RT-PCR reaction, 4–5 U (0.5 μL) of AMV reverse transcriptase and 2 U (0.5 μL) of Expand HiFi polymerase are added to the mixture.</div><div>3. PCR mapping is carried out by using combination of primers from different posi- tions in the construct. If all PCR fragments show the expected size, it indicates that the correct construct has been obtained.</div><div>4. In general, library diversity is examined by analysis of individual clones using DNA fingerprinting first and then DNA sequencing. DNA fingerprinting is a simple and rapid way to analyze unique clones. Clones that show different restriction pat- terns should have different sequences. We usually sequence 50 clones to analyze the distribution of various gene families and lengths of CDR3.</div><div>5. The PCR libraries are usually stored in ddH2O at –20°C for routine use. For long- term storage, ethanol-precipitate the DNA and store dry at –20°C.</div><div>6. The volume of TNT mixture used for ribosome display can be scaled up to 100 μL or down to 20 μL without significant reduction in recovery efficiency.</div><div>7. Magnesium acetate concentration added to TNT mixture during translation affects ARM generation and recovery. We have shown that antibodies can be more efficiently displayed and recovered with magnesium concentrations ranging from 0.5–2 mM.</div><div>8. PCR and RT-PCR can be performed in 10–100 μL according to applications. A negative control lacking a template should be always included in every experiment to evaluate DNA or mRNA contamination.</div><div>9. Nonspecific DNA recovery can occur for a number of reasons, including carryover of input DNA (despite DNase I digestion), nonspecific binding of ARMs or mRNA to beads through the washing procedure, or inadequate coating and blocking of the Dynabeads. PCR (RT-omitted) of the Dynabeads after selection can be used to detect contamination from input DNA. If necessary, further DNase I digestion on the Dynabeads may then be carried out to remove DNA completely. Increasing the number of washes, particularly using ddH2O, can reduce background nonspecific binding of the complexes to beads.</div><div>10. Sometimes no RT-PCR product is detected after ribosome display cycle. This may merely indicate that the species being selected is rare and that further cycles are required. However, other factors can account for lack of recovery, including the efficiency of RT-PCR, DNA transcription/translation, RNA degradation or func- tionality of the nascent protein. The use of a standard internal control mRNA can monitor RT-PCR efficiency. It is possible to add RNase inhibitors to the washing buffer to prevent mRNA degradation when necessary.</div><div>11. The number of cycles required to detect enrichment depends on the nature of the antigen and library diversity. Enrichment usually refers to the relative increase of a target molecule to background after selection. It can be estimated by comparing the ratios of input DNA and recovered DNA in each cycle. Generally, 3–5 cycles should be sufficient to enrich a target from a library.</div>
== Ribosome Display for Nanobody&nbsp; Discovery ==

Llama VHH antibody fragments against GFAP: Better diffusion in fixed tissues than classical monoclonal antibodies 

DOI: 10.1007/s00401-009-0572-6

Antigen preparation and induction of humoral immune response in alpaca 250 ll of hGFAP (1 mg/ml) were mixed with 250 ul of Freund complete adjuvant for the first immunization, and with 250 ul of Freund incomplete adjuvant for the following immunizations (In France, an ethical approval is not required for immunization of animals with Freund (in-) complete adjuvant.). One young adult male alpaca (Lama pacos) was immunized subcutaneously at days 0, 21 and 35 with 250 ug of this antigen preparation. The alpaca was bled and the immune response was monitored by the titration of serum samples by ELISA on GFAP. 

Constitution of a VHH library 

The blood of the immunized animal was collected; the lymphocytes were isolated by centrifugation on a Ficoll (Pharmacia) discontinuous gradient and stored at -80oC until further use. Total RNA and cDNA were obtained as previously described [21]. DNA fragments encoding only the VHH domains were amplified by PCR according to Lafaye et al. [20]. The primers specific for VHH were complementary to the 50 and 30 ends of the amplified product and incorporated Sfi1 and Not1 restriction sites at the ends of the VHH genes. The PCR products were digested and ligated into phage vector pHEN 1 [19]. The VHH population was converted to ribosome-display format using PCR and transcribed to mRNA as described [24, 36] with some modifications. Briefly, clones from the VHH population were amplified using a primer 

VHH-SPEF (5'GGAGATATATATCCATGAGAGGATCGCATCACC ATCACCATCACGGATCCGCCGAKGTSCAGCTG-3') that contained a 50 extension containing the prokaryotic Shine–Dalgarno sequence and a primer 

VHH-SPER (5'CC ATATAAAGCTTTGAGGAGACGGTGACCTG-3'). The 400 bp PCR product was then amplified using a mixture of 

SDA-MRGS primer (5 uM) (5'AGACCACAACGGTTT CCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGG AGATATATCCATGAGAGGATCG-3'), SPER primer (5 uM) and T7C (5 uM) (5'-ATACGAAATTAATA CGACTCACTATAGGGAGACCACAACGGTTTCCCT C-3'). The 450 bp product was purified with the Wizard SV purification kit (Promega). A peptide linker, lacking a stop codon, was added to ensure that the protein displayed on the ribosome was accessible to potential ligands. DNA encoding this linker, corresponding to a part of the E. coli protein TolA was PCR amplified using primers VHH-link (5'-CAGGTC ACCGTCTCCTCAAAGCTTTATATGGCCTCGGGGGC C-3') and TolAkurz (5'-CCGCACACCAGTAAGGTGT GCGGTTTCAGTTGCCGCTTTCTTTCT-3'). Finally, the library was assembled with the TolA linker by PCR assembly using primers TolAkurz and T7B (5'-ATACGA AATTAATACGACTCACTATAGGGAGACCACAACG G-3'). The final assembly product corresponded to a library of VHH with all of the 5' and 3' regions necessary to its use for ribosome-display selections. Ribosome-display selection rounds Principle Ribosome-display technology enables in vitro selection of a protein together with the mRNA that encodes it. A DNA library coding for a particular proteins, for instance VHH fragments, is transcribed in vitro. The mRNA is purified and used for in vitro translation. Because the mRNA lacks a stop codon, the ribosome stalls at the end of the mRNA, giving rise to a ternary complex of mRNA, ribosome and functional protein [16]. A library of these ternary complexes is tested against the potential ligand (in the case of antibodies, against the antigen). The binding of the ternary complex (ribosome, mRNA and protein) to the ligand allows the recovery of the encoding mRNA that is linked to it and that can be transcribed into cDNA by reverse transcriptase-PCR (RT-PCR). Cycles of selection and recovery can be iterated both to enrich rare ligand-binding molecules, and to select molecules with the best affinity.

Technique Glial fibrillary acidic protein (10 ug/ml) was bound in a Maxisorp plate (Nunc) and selections by Glial fibrillary acidic protein (10 ug/ml) was bound in a Maxisorp plate (Nunc) and selections by ribosome display were performed at 4oC. Selection was performed according to Zahnd et al. [36]. The wells were blocked with 300 ll 0.5% BSA in TBS for 1 h at RT. Before the ribosome-display round, the wells were extensively washed with WBT buffer (50 mM Tris acetic acid, pH 7.5, 150 mM NaCl, 50 mm Mg(CH3COO-)2, 0.05% tween 20). A ribosome display round consisted in a 15 min pre-panning step on a well coated with PBS and a 1 h binding step on the target protein. After washing (round 1: 6 washes in WBT, 5 s each, round 2: 6 washes 5 min each and round 3: same as round 2 with 3 additional washes 30 min each), RNA purification and reverse transcription (with oligonucleotide SPER), a first PCR was done using oligonucleotides VHH-SPEF and VHHSPER. This RT-PCR product was purified on an agarose gel and re-amplified in a second PCR using T7C, SDAMRGS and SPER. This PCR product was purified on an agarose gel and re-amplified in a third PCR using T7b and TolAkurz. The third PCR product served as template for the next round of ribosome-display format. Three rounds of selection were performed to isolate high-affinity binders.

VHH was expressed either with a His-tag or with a CH2 domain, allowing its recognition by anti-tag or anti-alpaca antibodies VHH expression with a His-tag The coding sequence of the VHH was subcloned in vector pET 22 using the NcoI and NotI restriction sites allowing the expression of VHHs in frame with a His-tag at the carboxy terminal end (Novagen, Darmstadt, Germany). The expression and purification of VHH were performed according to Lafaye et al. [20]. The plasmids containing the VHH were sequenced by Genome Express using T7 promoter and T7 terminator primers. Expression of VHH with the CH2 domain Anti-His-tag antibodies may prove to be difficult to use in IHC experiments. This is why VHHs coupled with the CH2 domain were also prepared. Specific and sensitive rabbit anti-alpaca antibodies-directed against the CH2 domain are available [20]. Moreover, secondary anti-rabbit antibodies conjugated with horseradish peroxidase are routinely used in Neuropathology Laboratories. The alpaca immunoglobulin CH2 domain was amplified by RT-PCR using primer CH2-Fwd-Not and CH2-Rev-Xho [20]. These primers contain respectively a NotI and a Xho1 site allowing the cloning of CH2 domain in pET 22 vector in frame with VHH gene. The expression and purification of VHH were performed according to Lafaye et al. [20].

Determination of dissociation constants by ELISA 

We determined the binding affinity of VHHs as described elsewhere [13]. Briefly, various concentrations of GFAP were incubated in solution overnight at 4oC with a known quantity of VHH until equilibrium was reached. The VHH concentration had been determined by preliminary ELISA calibrations. One hundred microliter of solution was transferred to a well of a microtiter plate previously coated with GFAP and was incubated for 20 min at 4oC. The plates were washed with PBS–Tween 0.1%. VHHs were detected with rabbit anti-His-tag antibodies (eBiosciences, San Diego, CA) followed by the addition of b-galactosidase- conjugated goat anti-rabbit Igs (Biosys, Compie`gne, France) and 4-methylumbelliferyl b-D galactoside (Sigma Aldrich, Saint-Quentin Fallavier, France). Fluorescence was read at 460 nm, after the excitation at 355 nm. KD was estimated from the slope of the regression curve obtained by plotting the reciprocal of the fraction of bound antibody versus the reciprocal of the molar concentration of antigen.
[[Category:Antibodies]]