Editing VLP as Antigen

'''AP205'''

'''QBeta'''

'''[[File:Pac vlp.png|RTENOTITLE]]'''



5’-GTGG

AGATCT

T7 promoter

TAATACGACTCACTATAGGG



Qβ RNA hairpin (Qbeta pac signal)<br/>AAATGCATGTCTAAGACAGCATCTTCGCG

targeting sequence

CAACATTCTGGGACACAAATTG

miR-30b GFP

CTGTGAAGCCACAGATGGG

targeting sequence complement

CAATTTGTGTCCCAGAATGTTG

TGC

T7 terminator

CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

CTCGAG

GGTG-3





The native infectious Qβ virion displays 3–5 copies of a large (approximately 200 amino acids) domain extension at the C-terminus, termed the A1 protein, which is used to recognize the E. coli host

The number of incorporated extensions varied inversely with their length, from a minimum of 10 per particle for a modified version of the full-length A1 protein to a maximum of 81 per particle for extensions of 11–24 amino acids derived from the A1 sequence



Function, structure, and production of the most commonly used protein-based nanoparticles (PNPs).

{| border="1"
|-
! PNP
! Native Organism
! Biological Function
! Geometry
! Number of Subunits
! Size (Diameter)
! Heterologous Production
| <br/>
|-
| rowspan="1" colspan="7" | Virus-like particles (VLPs)<br/>
|-
| CCMV <sup>1</sup>
| Cowpea chlorotic mottle virus capsid protein
| <br/>Plant virus
| Icosahedral
| 182
| 28 nm
| Plants; yeast;<br/>Escherichia coli; Pseudomonas fluorescens
|-
| CPMV <sup>2</sup>
| Cowpea mosaic virus capsid protein
| Plant virus
| Pseudo icosahedral
| 120 Large (L) and 120 Small (S)
| 28 nm
| Insect cells; plants
|-
| HBc <sup>3</sup>
| Hepatitis B virus capsid protein
| Human virus
| Icosahedral
| 180 or 240
| 30 nm or 34 nm
| Mammalian cells; insect cells; plants; yeast; E. coli; cell-free
|-
| MS2
| Enterobacteriaceae
| Bacteriophage
| Icosahedral
| 180
| 26 nm
| Yeast; E. coli; cell-free
|-
| P22
| Salmonella typhimurium
| Bacteriophage
| Icosahedral
| 420
| 60 nm
| E. coli
|-
| Qbeta
| E. coli
| Bacteriophage
| Icosahedral
| 180
| 28 nm
| Yeast; E. coli; cell-free
|-
| Non-viral PNPs
|-
| Dps <sup>4</sup>(mini-ferritin)
| Archaea; Bacteria (e.g., Listeria innocua)
| Involved in oxidative and starvation responses
| Tetrahedral
| 12
| 9 nm
| E. coli
|-
| E2
| Bacillus stearothermophilus
| Core of the pyruvate dehydrogenase multienzyme complex
| Dodecahedral
| 60
| 24 nm
| E. coli
|-
| Encapsulin
| Archaea; Bacteria
| Involved in oxidative stress response
| Icosahedral
| 60 or 180
| 20~40 nm
| Mammalian cells; yeast; E. coli
|-
| Ferritin (maxi-ferritin)
| Archaea; Bacteria; Eukarya
| Iron storage
| Octahedral
| 24
| 12 nm
| Mammalian cells; insect cells; yeast; E. coli
|-
| Hsp <sup>5</sup>
| Archaea; Bacteria; Eukarya (e.g., Methanococcus jannaschii)
| Chaperone
| Octahedral
| 24
| 12 nm
| E. coli
|-
| Lumazine synthase
| Archaea; Bacteria; Eukarya (e.g., Aquifex aeolicus)
| Mediates the biosynthesis of riboflavin
| Icosahedral
| 60
| 15.4 nm
| E. coli
|-
| Vault protein
| Eukarya
| Involved in signaling and immune responses
| 39-fold dihedral
| 78 Major vault protein
| Diameter: 40 nm<br/>Length: 67 nm
| Insect cells; cell-free
|}

1 Cowpea chlorotic mottle virus, 2 Cowpea mosaic virus, 3 Hepatitis virus, 4 DNA-binding proteins from starved cells, 5 Heat shock proteins.

'''Table 2.''' Methods used to bioengineer the most commonly used PNPs for a range of bioapplications.

{| border="1"
|-
! rowspan="2" | 
! rowspan="2" | PNP
! rowspan="2" | In Vitro Loading Mechanism
! rowspan="2" | Cov Biocon 1
! rowspan="2" | Point Mut 2
! rowspan="2" | UAA 3
! rowspan="2" | Pep Disp 4
! rowspan="2" | Prot Disp 5
! rowspan="2" | Modul Assem 6
! colspan="3" | Encapsulated Cargo
! rowspan="2" | Applications
|-
! Diffusion 7
! In Vitro
! In Vivo
|-
| rowspan="6" | VLPs
| CCMV
| pH; Ionic strength
| *
| *
| 
| *
| *
| 
| 
| Metals; small-molecule drugs; nucleic acids; organic polymers
| 
| Drug delivery; vaccines; bioimaging; prodrug activation; biocatalysis
|-
| CPMV
| 
| *
| *
| 
| *
| *
| 
| Metals; fluorescent probes; biotin; organic polymers
| 
| 
| Drug delivery; vaccines; bioimaging
|-
| HBc
| Denaturants
| *
| *
| *
| *
| *
| *
| 
| Metals; small-molecule drugs; fluorescent probes; nucleic acids
| 
| Drug delivery; vaccines; bioimaging
|-
| MS2
| pH; Denaturants
| *
| *
| *
| *
| *
| 
| Fluorescent probes; photosensitizers
| Metals; small-molecule drugs; nucleic acids
| Proteins
| Drug delivery; vaccines; bioimaging; biocatalysis
|-
| P22
| pH
| *
| *
| 
| *
| 
| *
| Metals; fluorescent probes; biotin; organometallic polymers
| Proteins
| Proteins; peptides; epitopes; nucleic acids
| Drug delivery; vaccines; nanomaterial synthesis; biocatalysis; solubility enhancement
|-
| Qβ
| pH; Denaturants
| *
| *
| *
| *
| *
| 
| Fluorescent probes; cationic polymers
| Metals; small-molecule drugs; fluorescent probes; nucleic acids
| Proteins
| Drug delivery; vaccines; bioimaging; nanomaterial synthesis
|-
| colspan="1" rowspan="7" | <br/><br/><br/><br/><br/><br/>Non-viral PNP
| Dps
| 
| *
| 
| 
| *
| 
| *
| Metals
| 
| 
| Drug delivery; nanomaterial synthesis
|-
| E2
| Denaturants
| *
| *
| 
| *
| *
| *
| Small-molecule drugs; fluorescent probes
| Nucleic acids
| 
| Drug delivery; vaccines; biocatalysis; antibody purification
|-
| Encapsulin
| pH; Denaturants
| *
| *
| 
| *
| *
| 
| Metals
| Proteins
| Proteins
| Drug delivery; bioimaging; immunotherapy; antimicrobials; biocatalysis
|-
| Ferritin
| pH
| *
| *
| *
| *
| 
| *
| Metals; small-molecule drugs
| Bioactive compounds; metals; small-molecule drugs
| Metals
| Solubility enhancement; drug delivery; vaccines; bioimaging; immunotherapy; nanomaterial synthesis
|-
| Hsp
| Temperature
| *
| *
| 
| *
| *
| 
| Metals
| Metals; small-molecule drugs; dyes; fluorescent probes
| 
| Drug delivery; nanomaterial synthesis; biocatalysis
|-
| LS
| Ionic strength
| *
| *
| 
| *
| *
| *
| 
| Proteins
| 
| Drug delivery; vaccines; bioimaging; biocatalysis
|-
| Vault
| “Breathing mechanism”
| *
| 
| 
| *
| 
| 
| 
| Metals; proteins; epitopes; antigens
| Proteins
| Solubility enhancement; drug delivery; vaccines; bioimaging; immunotherapy; bioremediation
|}

<sup>1</sup> Covalent bioconjugation; <sup>2</sup> Point Mutation; <sup>3</sup> Unnatural amino acid incorporation; <sup>4</sup> Peptide display; <sup>5</sup> Whole protein display; <sup>6</sup> Modular assembly; <sup>7</sup> Pore-mediated diffusion
[[Category:VLP]]