SMARTer RACE Primers: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

3 May 2018

  • curprev 11:5111:51, 3 May 2018 Paul.xu talk contribs 633 bytes +633 Created page with "The forward primers in the Nested Universal Primer A of the SMARTer RACE cDNA  Amplification Kit 5′–AAGCAGTGGTATCAACGCAGAGT–3′ Reverse primers: ..."
Retrieved from "https://eln.excellgen.com/index.php?title=SMARTer_RACE_Primers"