2264 pT7A3E-Gst-Pol-1: Difference between revisions
Jump to navigation
Jump to search
No edit summary |
(No difference)
|
Latest revision as of 17:40, 30 January 2015
Cloning of 2264 pT7A3E-Gst-Pol-1
[edit]Purpose: Cloning of2264 pT7A3E-Gst-Pol-1==
Date: 2014-7----
Notebook:0
Page:
Clone ID:2264
Experimenters: shanyi
Results
[edit]CLONING
[edit]PCR from Geobacillus stearothermophilus genomic DNA
Gst-Pol-Nde1-F tagcacatatggacaaagtagctccgcaaac
Gst-Pol-HindIII-R (catggtatgacgcaaagtaa aagctt atcat) atgataagcttttactttgcgtcataccatg
digest with Nde1 + HindIII, clone to 1892
Colony Screening
[edit]Date: 2014_7
Make miniprep, use Nde1 + HindIII to find positive clone
Result intepretation/Summary
[edit]Conclusion
[edit]Purufucation
[edit]lot#:81-2264
