353 pET28b-TaqMuts: Difference between revisions
No edit summary |
(No difference)
|
Latest revision as of 19:07, 21 August 2011
Cloning of TaqMuts to pET28b
[edit]Purpose: SubCloning of TaqMuts from pET30a to the pET28b (353).
Date: 2011-8-19 to 2011-8-23
Notebook:
Page:
Clone ID:
Experimenters: Paul
Results
[edit]Digestion Analysis
[edit]Date: 2011-8-19
| Lane |
Sample |
Digestion |
| 1 |
pET3a-Muts |
Nde1+EcoR1 |
| 2 |
pET3a-Muts |
NdeI+HindIII |
| 3 |
pET3a-Muts |
NdeI+BamH1 |
| 4 |
pET3a-Muts |
BamH1 |
| 5 |
pDB.His.MBP |
NdeI+EcoR1 |
| 6 |
pET28b |
NdeI+EcoR1 |
Looks like there is no HindIII and EcoR1 sites in pET3a_Muts
From published paper, the TaqMuts cDNA can be cut out with NdeI+ BamH1, but there is a BamH1 site within the gene.
PCR
[edit]Date: 2011-8-19
Primer F: Taq-Muts-F cata cat atggaaggcat gctgaagggc
Primer-R: Taq-Muts-R cgatgaattctcaccccttcatggtatccaag
Cut out TaqMuts bands, purify with spin column.
Digest with NdeI + EcoR1, ligate to NdeI+ EcoR1 digested pET28b.
Transform 10 ul using STBL3, grow on LB/Kan O/N
Colony Screening
[edit]Date: 2011-8-21
digest 5 ul DNA with NdeI + EcoR1
clone 2 & 6 look good.
send clone 2 for sequencing T7-F and T7-R