NGS Library Preparation

Fragmentase 

NEBNext dsDNA Fragmentase is com-posed of endonucleases isolated from two different E. coli sources: one construct expresses a fusion protein consisting of E. coli maltose binding pro-tein and Vibrio vulnificus nuclease mutant protein; the other expresses a fusion protein consisting of maltose binding protein and T7 endonuclease mutant protein.

Enzymatic methods to shear DNA into small pieces include DNAse I, a combination of maltose binding protein (MBP)-T7 Endo I and a non-specific nuclease Vibrio vulnificus (Vvn), NEB’s (Ipswich, MA) Fragmentase and Nextera tagmentation technology (Illumina, San Diego, CA)

Both enzymes are MBP-fusion

Periplasmic nuclease Vvn https://www.ncbi.nlm.nih.gov/pmc/articles/PMC169050/

Clone ID 942

T7 Endo 1

Clone ID: 941 pT7A3-pMBP-T7-Endo-1, 1225 pET28b-T7-Endo1 <--- not going to work

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1277808/

patent: 8048664

Making a stable single catalytic domain of T7 Endo I T7 Endo I is a symmetrical homodimer. It consists of two catalytic domains connected by a β-sheet bridge. Each domain is comprised of residues 17–44 from one subunit and residues 50–145 from other subunit (6). Initial attempts were made to produce a SCD protein as a heterodimer of an N-terminal part (residues 1–46) and a C-terminal part (residues 47–149) of T7 Endo I by co-expression of separately-translated fragments. A second approach was made to fragment the full-length homodimer into two parts by introducing a protease (Genenase) cleavage site (P46H, A47Y) into the center of β-bridge of the full-length enzyme followed by cleavage of the purified mutant enzyme with Genenase. Neither approach resulted in a stable SCD protein dimer. The failure to directly produce this SCD protein might be due to instability of the heterodimeric SCD lacking the stabilizing bridge of the full-length enzyme.

In order to facilitate folding of SCD into a stable heterodimer, we added a dimerization functionality to the separately-translated catalytic-domain fragments. This approach employed a trans-splicing intein system from the DnaE gene of Synechocystis sp. PCC6803 (10). This system is known to mediate tight association of fusion partners, sufficient to restore catalytic activity to separated enzyme domains.

The experimental procedure is illustrated in Figure 1A. Briefly, two expression plasmids, pMEn-In and pIc-Ec, were constructed as described in Materials and Methods. The two plasmids were used to produce two polypeptides MEn–In and Ic–Ec. Ic–Ec was insoluble when expressed in E.coli. A soluble form of Ic–Ec was obtained by refolding the polypeptide in vitro. For assembly and purification of SCD protein, MEn–In/Ic–Ec, MEn–In was first bound to an amylose column followed by passage of excess amounts of soluble Ic–Ec through the column. After washing out the unbound Ic–Ec, the dimeric SCD protein MEn–In/Ic–Ec was eluted from the column with maltose buffer.

Recombinant DNA and mutagenesis DNA manipulation was performed as described in Molecular Cloning by Sambrook et al. (11). Site-directed mutagenesis by two-step PCR was described previously (9). For generating En–In gene fusion by two-step PCR, two template plasmids pEndo I (9) and pMEB2 and the following four primers were used: oligo-1, GCCGAATTCATGGCAGGTTACGGCGCTAAAGGAATC; oligo-2, TTCGGTACCAAAAGACAGGGCATTGCTCGCCGGAATTAC; oligo-3, GTAATTCCGGCGAGCAATGCCCTGTCTTTTGGTACCGAA; and oligo-4, CCCGGAAGCTTATTTAATTGTCCCAGCGTCAAGTAATGG.

In the first step PCR plasmid pEndo I, oligo-1 and oligo-2 were used for generating the N-terminal part (En) coding sequence of T7 Endo I; pMEB2, oligo-3 and oligo-4 were used for generating the N-terminal part (In) coding sequence of the trans-splicing intein. The first cysteine of In was changed to alanine to prevent autoproteolysis of the desired SCD protein (10). In the second PCR step, the En–In gene fusion was assembled by using the two products (En and In) of the first PCR step as templates, oligo-1 and oligo-4 as primers. The Ic–Ec gene fusion was generated in a similar way. Plasmid pKEB12; oligo-5, ATAGACCATGGTTAAAGTTATCGGTGCTAGATCTCTGGGC; and oligo-6, AATGCTCGCCGGAATTACGTTAGCTGCGATAGCGCC, were used for generating the C-terminal portion (Ic) coding sequence of intein. Plasmid pEndo I; oligo-7, GGCGCTATCGCAGCTAACGTAATTCCGGCGAGCAAT; and oligo-8, GGCCGCTGCAGTTATTTCTTTCCTCCTTTCCTTTTTAATCT, were used for generating the C-terminal portion (Ec) coding sequence of T7 Endo I. The Ic–Ec gene fusion was assembled by PCR using both products (Ic and Ec) of the first PCR step as templates and oligo-5 and oligo-8 as primers. Expression plasmid pMEn–In which contained the coding sequence for MBP–En–In protein fusion, named MEn–In, was constructed by inserting the En–In coding sequence into the EcoRI–HindIII site of pMAL-c2x after being digested with the same restriction enzymes. Expression plasmid pIc-Ec was constructed by replacing the DNA between the NcoI and PstI sites of pKEB12 with the Ic–Ec coding sequence after being digested with the same restriction enzymes. All cloned DNA was verified by DNA sequence analysis.

For purification of unfolded insoluble protein Ic–Ec or Ic–Ec(∇9), cells from one liter of culture were harvested and lysed by sonication in 50 ml of sonication buffer (10 mM Tris, pH 7.6, 50 mM NaCl and 1 mM EDTA). The insoluble pellets were saved, washed with 100 ml of high salt buffer (1.0 M NaCl) once, 100 ml distilled water twice, 100 ml 0.5% Triton X-100 twice, 100 ml distilled water twice, and then with 100 ml of sonication buffer. The pellets were saved and dissolved in 40 ml of 6 M guanidine hydrochloride containing 20 mM Tris, pH 7.6, 50 mM NaCl, 20 mM DTT and 1 mM EDTA. The solution, after clearing by centrifugation (14 000 r.p.m., JA-17 rotor, 20 min), was dialyzed against 500 ml of refolding buffer (20 mM Tris, pH 7.6, 50 mM NaCl, 2 mM DTT and 1 mM EDTA) with four changes at 4°C. The refolded soluble protein and unfolded precipitates were separated by centrifugation (12 000 r.p.m., JA-17 rotor, 20 min). About 10 mg of soluble Ic–Ec or Ic–Ec(∇9) were routinely obtained from one liter of induced culture. About 30 mg of MEn–In or MEn–In(9) were routinely purified using an amylose column from one liter of induced culture. For assembling dimeric SCD protein on an amylose column, the cells containing MEn–In or MEn–In(9) from 0.5 l of induced culture were harvested and lysed by sonication in 25 ml of sonication buffer on ice. The cell debris was removed by centrifugation (12 000 r.p.m., JA-17 rotor, 20 min) and the crude cellular extracts loaded onto the column. After briefly washing with two column volumes (40 ml) of refolding buffer, 10 mg of soluble Ic–Ec or Ic–Ec(∇9) was loaded onto the column. The flow-through fractions were collected and reloaded onto the column. The column was then washed with 500 ml of refolding buffer and eluted with the same buffer containing 10 mM maltose. SCD protein-containing fractions were pooled, dialyzed against refolding buffer containing 50% glycerol and kept at −20°C until use. About 20 mg of SCD proteins are obtained routinely by the procedure described above.

https://patents.google.com/patent/US7851192B2

read these two before making T7 Endo I using spycatcher/spytag

https://www.ncbi.nlm.nih.gov/pubmed/16264086

https://patents.google.com/patent/US7851192B2/en

SD Polymerase

 For fragmentation, 200 ng gDNA of E.coli strain BL21(DE3) was added to the reaction 83mixture: 1X reaction buffer for SD polymerase (Bioron GmbH), 3.5 mM MgCl2, dNTPs 0.25 mM 84(each), DNase I 1.5 ng/μl, SD DNA polymerase 1.5 U/μl. The total volume of the reaction was 25 85μl. The reaction mixture was completed at 4oC (wet ice). The fragmentation of gDNA was carried 86out by two-step incubation: 20 minutes at 30oC and then 20 minutes at 70oC. For incubation we 87used thermal cycler with heated lid.The reaction was stopped by cooling down to 10oC. The 88mixture was diluted 1:1 with sterile water and fragmented DNA was purified with SPRI beads.

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0210374

The genome Analyzer II workflow

consists of sample preparation, cluster amplification,
sequencing and data analysis.
Sample preparation

enome Analyzer II can utilize nucleic acids from various resources if it is provided in a
compatible format (de Magalhães, Finch & Janssens 2010, Schmidt et al. 2009,
Linnarsson 2010). The library consists of short fragments of double-stranded DNA.
These fragments should be approximately 150 to 500 base pairs long to have uniform
performance in cluster amplification. The fragments have adapters on both ends of the
fragment complementary to both adapters on flow cell and sequencing primers
(Linnarsson 2010, Pettersson, Lundeberg & Ahmadian 2009, Mardis 2008).
The primary step in standard library preparation protocol is fragmentation in which the
genomic DNA is sheared to short fragments of double-stranded DNA. The fragments that
have single-stranded overhangs at this point are then end repaired to generate blunt-
ended fragments. The addition of deoxyadenosine monophosphate (dAMP) to the 3’-end

of the strands enhances the efficiency of the correct ligation (Linnarsson 2010). The
polymerase chain reaction (PCR) amplification is also needed in order to enrich the
fragments that have been successfully prepared and thus have the adapters in both ends
and are capable of amplifying and attaching to a flow cell. (Figure 1)

Fragmentation
The fragmentation can be performed either by mechanical or sonar force or by enzymatic
reaction. The official Illumina sample preparation protocol uses pressurized air based
method called nebulization to fragment the DNA. Other means for fragmentation are
focused sonication (Covaris Inc., Woburn, MA, USA) and enzymatic fragmentation with
Fragmentase (New England Biolabs, Ipswich, MA, USA). In enzymatic fragmentation
random nicks are created by nuclease and the nicks are recognized by endonuclease
which cleaves the other strand (New England Biolabs 2010). Also DNaseI in the
presence of Mn 2+ fragments the DNA (Linnarsson 2010).
Sample yields from focused sonication can be more than four-fold compared to
nebulization since the fragment size distribution is narrower. The enzymatic methods
have wider size distribution than sonication but have better yields than nebulization
(Linnarsson 2010).

End repair
After the fragmentation the fragments have 3’ and 5’ overhangs which must be cut off in
order to have blunt-ended fragments which can be further prepared for adapter ligation.
T4 DNA polymerase catalyzes the synthesis of DNA in the 5’ -> 3’ direction thus filling
the 5’ overhangs and cleaves the 3’ overhangs with its 3’ -> 5’ exonuclease activity
(Orkin 1990).

A-tailing
The aim of incorporating deoxyadenosine monophosphate (dAMP) to the 3’ end of the
blunt-ended DNA fragment is to prevent the formation of concatemers in ligation and to
enhance the ligation efficiency. The adapters have complementary deoxythymidine
monophosphate (dTMP) in the 3’ end of the ligating end of the adapter which enables
successful ligation of the adapter. The deoxyadenosine triphosphates (dATP) are
incorporated by Klenow fragment which is an N-terminal truncation of DNA Polymerase
I which retains polymerase activity, but has lost the 5 ́→ 3 ́ exonuclease activity (Clark,
Joyce & Beardsley 1987).

Ligation
The ligation process incorporates adapters to both ends of the blunt-ended DNA
fragments. Successful ligation should result in different adapters in different ends of the
fragments. A dTMP on the 3’ end of the ligating end of the adapter enables the ligation to
the DNA fragment with 3’ end dAMP overhang. The DNA strands of the adapters are
complementary only on the ligating end of the adapter resulting in Y-shape. This
significantly reduces the formation of fragments with the same adapter in both ends of
the fragments (Linnarsson 2010). The phosphorotioate modifications in the ends of the
adapters protect the adapters from endonucleases. The ligation is performed by T4 DNA
ligase. T4 DNA ligase is an enzyme purified from E. coli C600 pcl857 pPLc28 lig8. It is
capable of catalyzing the phosphodiester bond formation of juxtaposed 5' phosphate and
3' hydroxyl termini of DNA and RNA. It can incorporate both blunt-ended and cohesive-
ended termini. (Engler, Richardson 1982)

Purification
After each sample preparation step the library must be purified from salts, enzymes,
surplus of adapters and other reagents. There are several approaches for purification from

DNA in a high-salt buffer binds to silica-gel- membrane. The additional substances are
removed, and the DNA eluted in a low-salt buffer. This method is susceptible to pH
changes. (Hamaguchi, Geiduschek 1962, Vogelstein, Gillespie 1979)
Gel filtration with resin
Gel filtration purification utilizes different method compared to the other purification
approaches. As in other methods DNA is bound to beads or membranes, in gel filtration
additional substances in the solution are separated from DNA during gel filtration.
Primers, short single stranded DNA strands, salts, buffers, deoxyribonucleotide
triphosphates (dNTP) and other small molecules are eluted in larger volume than large
molecules such as DNA. (EdgeBio 2010)
Paramagnetic bead purification
Solid Phase Reversible Immobilization (SPRI) beads have polystyrene core coated with a
layer of iron (Figure 2). The iron grants the beads their paramagnetic properties. The
surface of the bead is a polymer layer containing carboxyl functional groups. The SPRI
beads bind the negatively charged nucleic acid with the carboxyl groups leaving other
substances in the solution. The beads carrying the nucleic acid can be separated from the
solution by external magnetic field. This enables efficient washing and elution of the
DNA or RNA in proper elution buffer. (Beckman Coulter Genomics 2010, Deangelis,
Wang & Hawkins 1995)

A Modified RNA-Seq Approach for Whole Genome Sequencing of RNA Viruses

Library Preparation for Sequencing

Norovirus amplicon preparation for Sanger sequencing.

Reverse transcription and first strand cDNA synthesis were performed using the Accuscript High Fidelity 1st strand cDNA synthesis kit (Agilent, Santa Clara, California, USA) following the manufacturer's published protocol. PCR amplification was then performed using specific in-house primers covering the seven overlapping amplicons of the genome of Norovirus GII.4 (see Table S1), including internal primers to increase depth of coverage using Sanger sequencing. PCR products were then confirmed by agarose gel electrophoresis. The reaction products were separated and detected with a Prism 3730 automated DNA sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were assembled from the resultant chromatograms with the STADEN suite of computer programs [23]. Primer sequences at the 5′ and 3′ termini of the overlapping PCR amplicons were excluded.

Hepatitis C Sanger sequencing.

One-step reverse transcription and first-round PCR in two reactions amplified a 4-kb and a 7-kb product. Second-round nested PCR reactions used >20 PCR primers in pairs generating 10 overlapping viral genomic fragments each of approximately 1 kb, that were sequenced and aligned manually to a reference sequence as previously described [24].

Illumina RNA-Seq Library Preparation.

Total RNA quantity and integrity were assessed using Quant-IT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA) and Agilent Tapestation 2200 R6K. Libraries for Illumina sequencing were constructed from 100 ng of total RNA using the NEBNext mRNA Sample Prep Kit 1 (New England Biolabs, Ipswich, MA, USA), following the manufacturers' guidelines with minor modifications: end repair in 50 µl reaction volume (40 µl DNA, 5 µl buffer and 5 µl enzyme), post fragmentation clean-up with 1:2.8× volume Agencourt Ampure RNAClean XP (Beckman Coulter, Pasadena, CA, USA); post cDNA synthesis clean-up with 1:1.25× volume Ampure XP Beads; post end repair, A-Tailing and adapter ligation clean-ups with 1:1.8× volume Ampure XP Beads and post-PCR library clean-ups with 1:1× volume Ampure XP Beads. Additionally, upon ligation of Illumina Adapters (Multiplexing Sample Preparation Oligonucleotide Kit) each library was size selected with two Ampure Bead steps (firstly, 1:0.7× volume and secondly, the supernatant from the first bind was taken for a 1:1.7× volume clean-up), selecting 200–600 bp fragments in 30 µl 10 mM Tris-Cl, pH 8.5. Pre-PCR workflow was partially performed using a Beckman Biomek FX and post-PCR steps were performed using a Beckman Biomek NX^P and Biomek 3000.

The following custom primers (25 µM each) were used for the PCR enrichment step:

Multiplex PCR primer 1.0

5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCC​TACACGACGCTCTTCCGATCT-3′

Index primer

5′-CAAGCAGAAGACGGCATACGAGAT[INDEX]CAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′

Amplified libraries were analysed for size distribution using the Agilent Tapestation 2200 D1K. Libraries were quantified by quantitative RT-PCR using Agilent qPCR Library Quantification Kit and a Mx3005P instrument (Agilent) and relative volumes were pooled accordingly. Finally, a second quantitative RT-PCR was performed to measure the relative concentration of the pool compared to a previously sequenced mRNA library in order to determine the volume to use for sequencing.

Improved Fragmentation Library Preparation for Illumina.

To increase the library insert size of the sequenced libraries and to further investigate secondary structures within the Norovirus genome, a modified fragmentation method was developed. The total RNA was fragmented using 2 µl fragmentation buffer diluted 1:4 in nuclease-free water (fragmentation buffer included in the NEBNext mRNA Library Prep Master Mix Set), incubated at 94°C for 5 minutes, placed immediately to ice and followed by adding 2 µl stop solution (not diluted). Post-fragmentation clean-up through to adapter ligation clean-up were as above. Size selection was omitted to avoid losing longer fragments, and instead, an additional bead clean-up after ligation was performed to remove any remaining adapter dimer prior to PCR amplification.

Illumina Amplicon Library Preparation.

Amplicons were quantified and quality assessed using Quant-IT Qubit dsDNA High Sensitivity Assay (Invitrogen) and 1% E-gel (Invitrogen) respectively. Fifty nanograms were sheared to 400 bp using Covaris™ DNA Shearing (Woburn, MA, USA) and concentrated using 1:1× volume Ampure XP Beads. Eluted DNA fragments were then processed through standard library preparation procedures (end repair through to Ampure Bead size selection using the NEBNext DNA Library Prep Master Mix Set for Illumina). Post-reaction clean-ups were 1:1.8× volume Ampure XP Beads and post-PCR libraries were cleaned with 1:1× volume Ampure XP. Ten cycles of PCR amplification were performed using custom primers as above, and the final library was pooled with Norovirus positive samples from the pilot study.

Sequencing.

Multiplex libraries were prepared using barcoded primers and a median insert size of 150 bp (increased to 200 bp with the modified method). The pooled libraries from 3 initial Norovirus and 2 HCV samples were sequenced on an Illumina MiSeq with 150 bp paired end reads following standard Illumina protocols. An average of 0.5 Gb of sequence was produced per sample. A larger pool of 77 Norovirus samples was sequenced on an Illumina HiSeq 2000 with 100 bp paired end reads following standard Illumina protocols.

Data analysis.

Reference sequences for each organism were obtained from GenBank. For Norovirus the sequences were GII.4, and the Norovirus Hu/GII.4/Orange/NSW001P/2008/AU was used as a reference (accession number GQ845367). This was selected as the most common match to the Sanger sequenced 288 bp RT-PCR amplicon used in the diagnostic RT-PCR stage. For HCV the reference sequence used was the subtype 3a strain (accession number AF046866).

Sequences were mapped to the organism-specific reference using Stampy v1.0.14 [25] with no BWA pre-mapping. Bases and single nucleotide variants (SNVs) were called using the SAMtools “mpileup” command with options ‘-E -M0 -Q30 -q30 -o40 -e20 -h100 -m2 -D -S’ and BCFtools [26]. Sites were filtered to avoid unreliable calls using the following criteria:

1. A minimum depth of 5 reads at each position
2. A minimum average base quality of 10
3. A minimum SNV quality of 25
4. At least 75% of reads at the position support the call and the position was called as homozygous

Positions were called as heterozygous based on the SAMtools genotype calls. An evolutionary tree was created using BEAST (Bayesian evolutionary analysis sampling trees) depicting all the full genomic sequences with relatedness. Analysis was performed using BEAST v.1.7.5 combining two random number seed chains (10 million iterations each, saving 1 in 1,000 iterations, with a 1 million iteration burn-in) using: HKY substitution; estimated frequency; strict clock; and constant population size coalescent tree prior. This maximum clade credibility tree was computed using TreeAnnotator v.1.7.5 and plotted with Figtree v.1.4.0. [27].

The sequences reported in this paper have been deposited in the European Nucleotide Archive Sequence Read Archive under study accession number ERP002219. The Sanger sequences used for validation for Norovirus comparison have been submitted to EMBL under accession numbers HF952119-HF952135. For HCV, the Sanger sequences used for comparison were Genbank accession numbers GQ356201 and KC836883.