367pfu-pET30b: Difference between revisions
No edit summary |
(No difference)
|
Latest revision as of 09:55, 19 January 2012
gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp
Purpose: gene synthesis of T4 dna ligase and ligate to pet 28b and pdbhis.mbp.
Date: 2011-8-15
Notebook: Haiyan
Page:003023
Clone ID: 253
Experimenters: Haiyan
Results
Purpose: .
Date: 2011-10-18--
Notebook: Yingying Lu
Page:
Clone ID:367
Experimenters: Yingying Lu
Results
band 1,2,3 show PCR 1
381 plasmid as template
Pfu-Nde1-F1 + Pfu-Kpn1-R1
TATG---pfu--- GGTAC
band 4,5,6 PCR 2
381 plasmid as template
Pfu-Nde1-F2 + Pfu-Kpn1-R2
AC----pfu---- C
Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve
purify with spin column, elute with 20 ul water.
Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.
first digest with Kpn1 ,fast digest enzyme for 45 min
second digest with Nde1, NEB enzyme for 2 hours
10 different clonies digest detect: Kpn1+Nde1
Date: 2011-11-18--
Notebook: Yingying Lu
Page:
Clone ID:367
Experimenters: Yingying Lu
Results
band show PCR 1
381 plasmid as template
Pfu-Nde1-F1 + Pfu-Kpn1-R1
TATG---pfu--- GGTAC
band PCR 2
381 plasmid as template
Pfu-Nde1-F2 + Pfu-Kpn1-R2
AC----pfu---- C
Run gel, cut out bands, put into the same tube (i.e., one tube), add QG buffer, heat at 65 oC until dissolve
purify with spin column, elute with 20 ul water.
Heat 95 oC for 5min, turn off PCR machine, cool slowly to room temp.
band show digest vector
Nde1+Kpn1
Cloning of 367pfu-pET30b
[edit]Purpose: Cloning of367pfu-pET30b by PCR
Date: 2012-1-17--
Notebook:
Page:
Clone ID:367
Experimenters: yingying
Results
[edit]
cold fusion cloning method
template: 381-pSpeedET-Pfu
pfu-Nde1-F3 5 CTTTAAGAAGGAGATATA CATATG atgattttagatgtggattac 3
pfu-Kpn1-R3 GGCCTTGTCGTCGTCGTCGGTACC ggattttttaatgttaagccag
Subcloning
Date: 2012-
Colony Screening
[edit]Date: 2012-
Make miniprep and digest with
Result intepretation/Summary
[edit]Conclusion
[edit]