Protein Production using Baculovirus

Media and growing up SF9 cells

Tips for working in a sterile hood
Clean hood thoroughly with ethanol before use
Spray everything with ethanol before you move it into the hood
Avoid touching plastic pipettes with your gloves
When pipetting, try not to touch the walls of any flask or container
Never use cell culture media that has been opened before

Media
Grace’s insect medium (Gibco), supplemented 1x, Cat. No. 11605-102 (Invitrogen)
Pluronic F-68, 10 % (100 x), Cat no. 24040-032 (Invitrogen)

Preparation of suspension medium

Add 5 ml PenStrep (antibiotics) to 500 ml medium; final PenStrep conc. is 1%
For every 50 ml conical:
45 ml Grace medium containing 1 % PenStrep
5 ml FBS (fetal bovine serum)
0.5 ml Pluronic F-68, 10 % (100 x) (PA)

Make at least 4 conicals.

Thawing and adding of cryogenic cells
Don’t use 1. generation sf9 cells
Use cells that have been frozen in DMSO at a density of 10 mill. cells/ml from a cell culture that is only a couple of days old.
Take 2 tubes, both containing 1 ml of cells (10 mill. cells/ml), out of the liquid nitrogen freezer and thaw in a 26 oC water bath.
For every 1 ml aliquot of cells, resuspend in 5 ml suspension medium (+PA); since you have 20 mill. cells, add 10 ml suspension medium (+PA) (use 15 ml conical)
Spin for 7 min at 1000 rpm
Decant supernatant
Resuspend cells in desired amount of suspension medium; 30 ml suspension medium for 20 mill. cells; expected confluency = 0.667 mill cells/ml. Initially, cells should grow at low density (0.5 x 10⁶ cells/ml).
Transfer cell suspension into 50 ml spinner flask (autoclaved twice); note: always open flask from the same side and don’t close the cap so that air can enter the flask. Incubate at 26 oC while spinning slowly (setting 2).
Withdraw ca. 200 ul cell suspension and take the cell count. Mix 20 ul cell suspension with 20 ul trypan blue. Suck by capillary forces into flow chamber. Use 10 x magnification to count cells in 5 x 4 grid. Dead cells look like braun spots, whereas healthy cells have a bright ring. Actual number of cells: cell count in grid 25 x 2 (correction for dilution in dye) x factor 10⁴ = 0.5 mill. cells/ml.

Cloning

1.Clone target gene into pFastbac1 or pFastBac Dual
If His tag is required, add 6XHis tag to N-terminus.

GGATCC ATG TCG TAC TAC CAT CAC CAT CAC CAc CAt atg

If TEV site is needed, add the following sequence:
GGATCC ATG TCG TAC TAC CAT CAC CAT CAC CAT CAC GAT TAC GAT ATC CCA ACG ACC GAA AAC CTG TAT TTT CAG GGC catatg

2. Transform DH5alpha, Top10 or NEB Turbo, grow on LB/amp plate

3. Make plasmid and verify plasmid by restriction digestion, or sequencing

4. Make grlycerol stock.

Transform DH10Bac

1. Grow DH10Bac in 50 ug/ml kanamycin, 10 ug/ml tetracycline to log phase
2. Use CaCl2 protocol to make competent cells

3. Make 3 LB agar plates for each construct,
LB agar plate:
50 ug/ml kanamycin, 7 ug/ml gentamicin, 10 ug/ml tetracycline, 100 ug/ml Bluo-gal, and 40 ug/ml IPTG

4. Transform DH10Bac using recombinant plasmid.

5. Spin down cells, resubspend in remaining ~ 100 µl SOC medium, spread 15 µl to one plate, and 85 µl to another plate.

6. Incubate plates for 48 hours at 37 °C

7. Pick 10 most isolated large white colonies, and restreak them on fresh LB agar plates containing
LB agar plate:
50 ug/ml kanamycin, 7 ug/ml gentamicin, 10 ug/ml tetracycline, 100 ug/ml Bluo-gal, and 40 ug/ml IPTG. Incubate the plates overnight at 37 °C.

8. Pick 1 isolated large white colony from each parental colony, inocµlate a liquid cµlture containing 50 ug/ml kanamycin, 7 ug/ml gentamicin, 10 ug/ml tetracycline.

9. Make miniprep. Run gel to see if it is a big DNA.

10. Store bacmid DNA at –20°C.

11. Make glycerol stock and store at –80°C.

Bacmid DNA miniprep

1. Grow a single colony in 5 mL of LB containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline overnight. It’s best to start these cultures in the
morning, since the cells grow very slowly.

2. Make a glycerol stock by mixing 500 μL of the cells with 500 μL of 80% glycerol. Store in the -80 °C freezer.
3. Transfer the remaining culture to a 2-mL microcentrifuge tube and spin at maximum speed for 1 min.
4. Remove all of the supernatant using the vacuum aspirator.
5. Resuspend the cells in 300 μL of Qiagen Buffer P1. Do not use P1 containing the blue lysis indicator dye.
6. Add 300 μL of Qiagen Buffer P2, then incubate at room temperature for 5 min.
7. Slowly add 300 μL of Qiagen Buffer N3, mixing gently during addition. A thick white precipitate of protein and genomic DNA will form. Place the sample on ice for 5-10 min.
8. Centrifuge for 10 min at maximum speed. During this step, label another tube and add 800 μL isopropanol to it.
9. Gently transfer the supernatant into the tube containing the isopropanol. Avoid transferring any of the white precipitate. Mix gently by inverting the tube a few times and place on ice for 5-10 min. Note: The sample can be stored at -20 °C overnight (or over a weekend) to get higher yield.
10. Centrifuge for 15 min at maximum speed.
11. Remove the supernatant and add 500 μL of 70% ethanol. Invert the tube several times to wash the pellet. Centrifuge for 10 min at maximum speed. Repeat the wash step.
12. Inside biosafety hood, carefully remove all of the supernatant.
13. Do not dry the pellet. Resuspend the DNA in 50~100 μL of TE buffer.
14. Store DNA at 4 °C, until it is used for transfection. After transfection transfer plasmid to -20 °C freezer for long-term storage. Avoid repeated freeze-thaw cycles.

PCR Screnning

Use these two primers to do PCR
M13-F CCCAGTCACGACGTTGTAAAACG
M13-R AGCGGATAACAATTTCACACAGG

Recombinant bacmid DNA (50 ng) 0.5 µl
10X PCR Buffer (appropriate for enzyme) 2.5 µl
10 mM dNTP Mix 1 µl
PCR Primers (1 µl each of 10 µM stock) total 2 µl
Sterile Water 18.5 µl
Platinum Taq polymerase (5 units/μl) 0.5 µl
Total Volume 25 μl

PCR:
95 °C 2 min
25 to 35 cycles of
95 °C 30 sec
55 °C 45 sec
72 °C 5 min
Final: 72 °C. for 5 min

PCR product should be ~2300 bp + size of insert. If it is only ~300 bp, then is is empty vector.

Transfecting sf9 Insect Cells

Use Cellfectin II, Lipofectamine or GeneExpresso for transfection.

Grow sf9 cells in Grace’s Insect Cell Culture Medium, Unsupplemented (no antibiotics, no FBS), or Sf-900 II SFM or Sf-900TM III SFM in 6-well tissue culture plates

Make sure cels are 95% viability and are growing in the logarithmic phase with a density of 1.5 X10⁶ ~ 2.5X10⁶ cells/ml

if Sf9 or Sf21 insect cells are cultured in Supplemented Grace’s Insect Medium containing 10%FBS, use the following protocol to prepare cells for
transfection in a 6-well format. All amounts and volumes are given on a per well basis.

1. Verify that the Sf9 or Sf21 cells are in the log phase (1.5–2.5 X 10⁶ cells/ml) with greater than 95% viability.

2. If the cell density is in range of 1.5 X 10⁶–2.5 X 10⁶ cells/ml and the culture is without antibiotics, proceed to step 2a. If the cell density is not in this range or the cell culture contains antibiotics, follow steps 2b–2c:

a. Add 2 ml of Grace’s Insect Medium, Unsupplemented (without antibiotics and serum) in each well. Seed 8 × 10⁵ Sf9 or Sf21 cells from Step 1 per well.

Do not change medium or wash the cells. The medium carried over will enhance the transfection efficiency. Allow cells to attach for 15 minutes at
room temperature in the hood. Proceed to step 3.

b. Prepare 10ml plating medium by mixing 1.5 ml Supplemented Grace’s Insect Medium containing 10%FBS (without antibiotics) and 8.5 ml Grace’s
Insect Medium, Unsupplemented (without FBS and antibiotics).

c. Plate 8 × 105 Sf9 or Sf21 cells from Step 1 per well. Allow cells to attach for 15 minutes at room temperature in the hood. Remove the medium. Add
2.5 ml plating medium from step 2b per well. Proceed to step 3.

3. For each transfection sample, prepare complexes as follows:

a. Mix Cellfectin II before use, and dilute 8 μl in 100 μl Grace’s Medium, Unsupplemented (without antibiotics and serum). Vortex briefly to mix.
Note: You may leave this mixture at room temperature for up to 30 minutes.

b. Dilute 1 μl baculovirus DNA in 100 μl Grace’s Medium, Unsupplemented (without antibiotics and serum). Mix gently.

c. Combine the diluted DNA with diluted Cellfectin II (total volume ~210 μl). Mix gently and incubate for 15–30 minutes at room temperature.

4. Add ~210 μl DNA-lipid mixture or transfection mixture (Step 3c) dropwise onto the cells from Step 2. Incubate cells at 27°C for 3–5 hours.

5. Remove the transfection mixture and replace with 2 ml of complete growth medium (e.g., Grace’s Insect Medium, Supplemented and 10% FBS). Using
antibiotics is optional.

6. Incubate cells at 27°C for 72 hours or until you see signs of viral infection.

Signs of Infection	Phenotype	Description
Early (first 24 hours)	Increased cell diameter	A 25–50% increase in cell diameter may be seen.
	Increased size of cell nuclei	Nuclei may appear to "fill" the cells.
Late (24–72 hours)	Cessation of cell growth	Cells appear to stop growing when compared to a cell-only control.
	Granular appearance	Signs of viral budding; vesicular appearance to cells.
	Detachment	Cells release from the plate or flask.
Very Late (>72 hours)	Cell lysis	Cells appear lysed, and show signs of clearing in the monolayer.

Preparing the P1 Viral Stock

1. Once the transfected cells from above Step 6, demonstrate signs of late stage infection (e.g., 72 hours post-transfection), collect the medium containing virus from each well (~2 ml) and transfer to sterile 15 ml snap-cap tubes. Centrifuge the tubes at 500 X  g for 5 minutes to remove cells and large debris.

2. Transfer the clarified supernatant to fresh 15 ml snap-cap tubes. This is the P1 viral stock. Store at 4 °C.

Optional: filter viral supernatant through a 0.2 μm, low protein binding filter after the low-speed centrifugation step, if desired.

3. Store viral stocks as follows:
Store viral stock at 4 °C, protected from light.
If medium is serum-free (e.g., Sf-900 II SFM, Sf-900TM III SFM), add fetal bovine serum to a final concentration of 2%. Serum proteins act as substrates for proteases.
For long-term storage, store an aliquot of the viral stock at –80 °C for later reamplification.
Do not store routinely used viral stocks at temperatures below 4 °C. Repeated freeze/thaw cycles can result in a 10- to 100-fold decrease in virus titer.

Amplification P1 Baculoviral to get P2 Stock

Amplify P1 viral stock in a 10 ml suspension culture at 2 X10⁶ cells/ml or in 6-well tissue culture plates at 2 X 10⁶ cells/well. Calculate the number of Sf9 or Sf21 cells that you will need for infection and expand cells accordingly. Make sure that the cells are healthy, of low passage (5–20), and have >95% viability before proceeding to infection.

To amplifyviral stock, infect cells at a multiplicity of infection (MOI) ranging from 0.05 to 0.1. MOI is defined as the number of virus particles per cell. Use the following formula to calculate how much viral stock to add to obtain a specific MOI:

Inoculum required (ml) = (MOI (pfu/cell) x number of cells / titer of viral stock (pfu/ml))

Note: If the titer of P1 viral stock has not been determined , it is assumed that the titer ranges from 1 X 10⁶ to 1 X 10⁷ pfu/ml.

To infect a 10 ml culture at 2 X 10⁶ cells/ml using an MOI = 0.1. Assuming that the titer of P1 viral stock is 5 X 10⁶ pfu/ml.

Inoculum required (ml) = (0.1 pfu/cell 2 x 10⁷ cells /5 x 10⁶ pfu/ml)
Inoculum required (ml) = 0.4 ml

Several key points for successful amplification of baculovirus:

Use sterile P1 baculoviral stock that is free of contaminants
Use a low MOI between 0.05–0.1 as higher MOI will reduce baculovirus quality
Harvest the virus when 70–80% of cells are dead

Amplify P1 viral stock in a 6-well plate.

1. On the day of infection, prepare your Sf9 or Sf21 cell suspension and plate cells at 2 X 10⁶ cells/well. Incubate cells at room temperature for 1 hour to allow attachment.

2. After 1 hour, inspect cells under an inverted microscope to verify attachment.

3. Add the appropriate amount of P1 viral stock to each well.

4. Incubate the cells for 48 hours in a 27°C humidified incubator.

5. 48 hours post-infection, collect 2 ml of medium containing virus from each well and transfer to sterile 15 ml snap-cap tubes. Centrifuge the tubes at 500 X g for 5 minutes to remove cells and large debris and to obtain clarified baculoviral stock.

Note: It is possible to harvest virus at later times after infection (e.g., 72 hours). Optimal harvest times can vary and should be determined for each baculoviral construct. Remember that culture viability will decrease over time as cells lyse.

6. Transfer the supernatant to fresh 15 ml snap-cap tubes. This is the P2 viral stock. Store at 4 °C, protected from light. For long-term storage, store an aliquot of the P2 stock at –80 °C, protected from light.

7. Proceed to the next section to determine the titer of P2 viral stock.

Viral Plaque Assay

Plaquing Medium

1. Melt the 4% Agarose Gel by placing the bottle in a 70oC water bath for 20 to 30 minutes or heating the agarose in a microwave oven. While the 4% agarose gel is melting, place the following in the 40 oC water bath:
Empty, sterile 100 ml bottle
Sf-900 Medium (1.3X) or Grace’s Insect Cell Culture Medium (2X), as appropriate
2. Once the 4% agarose gel has liquefied, move the agarose gel, medium, and empty 100 ml bottle to a sterile hood.
3. Working quickly, prepare the plaquing medium as follows:

Sf-900 Plaquing Medium: Combine 30 ml of Sf-900 Medium (1.3X) and 10 ml of the melted 4% Agarose Gel in the empty 100 ml bottle and mix gently.
Grace’s Plaquing Medium: Add 20 ml of heat-inactivated FBS to the 100 ml bottle of Grace’s Insect Medium (2X) and mix. Combine 25 ml of the Grace’s
Insect Medium (2X) containing serum with 12.5 ml of cell-culture grade, sterile, distilled water and 12.5 ml of the melted 4% Agarose Gel in the empty
100 ml bottle and mix gently.
4. Return the bottle of plaquing medium to the 40oC water bath until use.

Titering

1. On the day of infection, harvest Sf9 or Sf21 cells and prepare a 30 ml cell suspension at 5 X 10⁵ cells/ml in Sf-900 II SFM (or other complete growth medium). Aliquot 2 ml of cell suspension into each well of two 6-well plates.

If you are including a negative control, you will need another 6-well plate.

2. Allow the cells to settle to the bottom of the plate and incubate, covered, at room temperature for 1 hour.

3. Following the 1 hour incubation, observe the cell monolayers using an inverted microscope. Sf9 cells should be attached and at 50% confluence.

4. Prepare an 8-log serial dilution (10^–1 to 10^–8) of the clarified baculoviral stock in Sf-900 II SFM or Grace’s Insect Cell Culture Medium, Supplemented, without FBS, as appropriate. To do this, sequentially dilute 0.5 ml of the baculoviral stock or previous dilution in 4.5 ml of medium in 12 ml disposable tubes. You should finish with 8 tubes of diluted viral stock (i.e., 10^–1, 10^–2, 10^–3, 10^–4, 10^–5, 10^–6, 10^–7, 10^–8). You will use the dilutions 10^–4 to 10^–8 in your assay.

5. Move the 6-well plates containing Sf9 cells and the tubes of diluted virus to the sterile hood. Label the plates, in columns of 2 (1 sample well plus 1 duplicate) as follows: no virus (negative control), 10^–4, 10^–5, 10^–6, 10^–7, 10^–8.

6. Remove the medium from each well, discard, and immediately replace with 1 ml of the appropriate virus dilution. As a negative control, add the
appropriate medium without virus.

7. Incubate cells with virus for 1 hour at room temperature.

8. Following the 1 hour incubation, move the cells and the bottle of plaquing medium from the 40oC water bath (Step 4, previous page) to a sterile hood.

9. Sequentially starting from the highest dilution (10^–8) to the lowest dilution (10^–4), remove the medium containing virus from the wells and replace with 2 ml of plaquing medium. Work quickly to avoid dessication of the cell monolayer.

10. Allow agarose overlay to harden for 1 hour at room temperature before moving the plates.

11. Incubate the cells in a 27 oC humidied incubator for 7–10 days until plaques are visible and ready to count.

Count the number of plaques present in each dilution, then use the following formula to calculate the titer (plaque forming units (pfu)/ml) of your viral stock.

Note that the optimal range to count is 3 to 20 plaques per well of a 6-well plate.

titer (pfu/ml) = number of plaques x dilution factor x (1 /ml of inoculum/well)

Example

In this example, we add 1 ml of inoculum and observe 20 plaques in the well containing the 10^–6 viral dilution. Using the formula above, the titer of this viral stock is:

titer (pfu/ml) = 20 plaques x 10⁶ x (1/1 ml of inoculum/well)

titer (pfu/ml) = 2 x 10⁷ pfu/ml

Samll Scale Expression

Use the following procedure for harvesting recombinant baculovirus infected insect cells to analyze expression of your recombinant protein of interest in a 24-well format

1. Seed 6 X 10⁵ Sf9 or Sf21 cells per well in a 24-well plate. Let cells attach for at least 30 minutes.
2. Remove the media and rinse the cells once with fresh growth media. Replace with 300 μl of fresh media.
3. Add baculoviral stock to each well at the desired MOI. Include the appropriate controls (e.g., mock-infected (uninfected) cells, pFastBac
positive control baculovirus, previously characterized recombinant baculoviruses).
4. Incubate cells in a 27 °C, humidified incubator.
5. Harvest cells (or media, if the recombinant protein is secreted) at the appropriate time (i.e., 24, 48, 72, 96 hours post-infection). If harvesting cells, remove the media and rinse the cells once with serum-free medium.
6. Lyse the cells with 400 μl of 1X SDS-PAGE Buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS).
7. Freeze samples at –20 °C or boil samples for at least 3 minutes.
8. Run SDS-PAGE and detect recombinant protein by western blot