Thermostable Luciferase

Mutant name	Source of the wt
Lucigen	P. pyralis	Glu354Arg, Asp357Tyr
Luc-T	L. crusiata	Thr217Ile	pDC57 Mammalian Luciferase Expression Vector  $267.45  The mutant luciferase also has been shown to remain stable at 37°C over long time periods, a characteristic not seen in wild type luciferases . It catalyzes the production of long wavelength (red) light (Em: 605) from D-Luciferin. Insert can be cut out from the vector using Xho1 and Not1
Ultra Glow	Photuris pennsylvanica	43 positions
Luc-5-pos	P. pyralis	Thr214Ala, Ile232Ala, Phe295Leu, Glu354Lys, Leu550Val

Lucigen, Luc-T and Ultra Glow have all been reported to display increased storage stability against heat. However, it was found that the Ultra Glow luciferase had a 10-times longer rise time compared to the wt P. pyralis luciferase. The Ultra Glow luciferase has a nearly 100-fold lower K M for ATP (0.7 μM) (Rita Hannah, personal communication) than what has been reported for the P. pyralis firefly luciferase (Branchini et al., 1998), which might explain the observed lower catalytic activity. In a Pyrosequencing reaction it is important that all ATP produced in each polymerization step reacts and generates light with firefly luciferase. If the firefly luciferase is to slow the apyrase has more time for degradation of the ATP and a lower signal will be recorded.

Coupled bioluminometric assays can now be perform at elevated temperatures using different strategies. In paper I the osmolyte strategy was used for studying of the ATP sulfurylase and DNA polymerase catalyzed reactions at 37°C. These assays were also successfully performed using a thermostable firefly luciferase. In figure 10, ATP sulfurylase was assayed by the osmolyte strategy and DNA polymerase by using a thermostable firefly luciferase. The activity of both enzymes were increased by over 100%, regardless of what strategy used, when the temperature was increased from 22°C to 37°C. It is worth noting that no loss in activity (assayed at 22°C) with or without glycine betaine could be observed after 1-hour storage at 37°C for either ATP
sulfurylase or DNA polymerase.

An interesting observation was made with the Japanese firefly luciferase mutant (Luc-T). When Luc-T was used in the Pyrosequencing reaction at 37°C the luciferase activity increased dramatically with increasing glycine betaine concentrations.

Similar results have been observed with a different Japanese firefly luciferase mutant (Luc-H) (Maria Murby, personal communication) but not with the Lucigen mutant. The stimulation in activity was only valid for the Japanese firefly mutants from L. crusiata while the North American firefly P. pyralis mutants were unaffected. It has been reported that firefly luciferase can aggregate at higher temperatures (Hannah et al., 1998; Lundovskikh et al., 1998).The aggregation leads to inactivation, which can be observed as reduced activity. Perhaps the L. crusiata mutants more easily form aggregates at higher temperatures than the P. pyralis mutants, and that the aggregation might be prevented by the presence of glycine betaine.

P.pyralis luciferase

These substitutions (F16R, L37Q, V183K, I234K and F465R) led to the enzyme with greatly improved pH-tolerance and stability up to 45°C. The mutant showed neither a decrease in specific activity relative to the wild-type luciferase (Law et al., 2006). Introduction of almost all known point mutations (12 residues) enhancing the thermostability of P. pyralis luciferase resulted in a highly stable mutant with half-time of inactivation of 15 min at 55°C, whereas wild-type luciferase inactivates within seconds at this conditions (Tisi et al., 2007)

Luc-T Sequence

based on pDC57

ATGGAAAACGACGAGAACATCGTGGTGGGCCCCAAGCCCTTCTACCCCATCGAGGAAGGCAGCGCCGGCACCCAGCTGCGGAAGTACATGGAAAGATACGCCAAGCTGGGCGCCATTGCCTTCACCAACGCCGTGACCGGCGTGGACTACAGCTACGCCGAGTACCTGGAAAAGAGCTGCTGCCTGGGCAAGGCTCTGCAGAACTACGGCCTGGTGGTGGACGGCCGGATCGCCCTGTGCAGCGAGAACTGCGAGGAATTCTTCATCCCCGTGATCGCCGGCCTGTTCATCGGCGTGGGCGTGGCTCCCACCAACGAGATCTACACCCTGCGGGAGCTGGTGCACAGCCTGGGCATCAGCAAGCCCACCATCGTGTTCAGCAGCAAGAAGGGCCTGGACAAAGTCATCACCGTGCAGAAAACCGTGACCACCATCAAGACCATCGTGATCCTGGACAGCAAGGTGGACTACCGGGGCTACCAGTGCCTGGACACCTTCATCAAGCGGAACACCCCCCCTGGCTTCCAGGCCAGCAGCTTCAAGACCGTGGAGGTGGACCGGAAAGAACAGGTGGCCCTGATCATGAACAGCAGCGGCAGCACCGGCCTGCCCAAGGGCGTGCAGCTGACCCACGAGAACACCGTGACCCGGTTCAGCCACGCCAGGGACCCCATCTACGGCAACCAGGTGTCCCCCGGCACCGCCGTGCTGACCGTGGTGCCCTTCCACCACGGCTTCGGCATGTTCACCACCCTGGGCTACCTGATCTGCGGCTTCCGGGTGGTGATGCTGACCAAGTTCGACGAGGAAACCTTCCTGAAAACCCTGCAGGACTACAAGTGCACCTACGTGATTCTGGTGCCCACCCTGTTCGCCATCCTGAACAAGAGCGAGCTGCTGAACAAGTACGACCTGAGCAACCTGGTGGAGATCGCCAGCGGCGGAGCCCCCCTGAGCAAAGAAGTGGGAGAGGCCGTCGCCAGGCGGTTCAATCTGCCCGGCGTGCGGCAGGGCTACGGCCTGACCGAGACAACCAGCGCCATCATCATCACCCCCGAGGGCGACGACAAGCCTGGAGCCAGCGGCAAGGTGGTGCCCCTGTTCAAGGCCAAAGTGATCGACCTGGACACCAAGAAGAGCCTGGGCCCCAACAGACGGGGCGAAGTGTGCGTGAAGGGCCCCATGCTGATGAAGGGCTACGTGAACAACCCCGAGGCCACCAAAGAGCTGATCGACGAAGAGGGCTGGCTGCACACCGGCGACATCGGCTACTACGACGAAGAGAAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAGTACAAGGGCTATCAGGTGCCCCCTGCCGAGCTGGAAAGCGTCCTGCTGCAGCACCCCAGCATCTTCGACGCCGGCGTGGCCGGGGTGCCAGATCCTGTGGCCGGCGAGCTGCCTGGCGCCGTGGTGGTGCTGGAATCCGGCAAGAACATGACCGAGAAAGAAGTGATGGACTACGTCGCCAGCCAGGTGTCCAACGCCAAGCGGCTGAGAGGCGGCGTGAGATTCGTGGACGAAGTGCCAAAGGGCCTGACCGGCAAGATCGACGGCAGGGCCATCCGGGAGATCCTGA