RT-PCR Analysis of TREC

1. http://www.ncbi.nlm.nih.gov/pubmed/15059846

TRECs were determined using real-time polymerase chain reaction (PCR) in an ABI Prism 7700 thermocycler (Applied Biosystems, Cheshire, United Kingdom). DNA was extracted from CD4 or CD8 purified T cells by incubation with 100 μg/mL proteinase K (Roche Diagnostics, Mannheim, Germany) for 1 hour at 56°C and then for 15 minutes at 95°C. Real-time PCR was performed in a volume of 25 μL containing 3.5 mM MgCl2, 200 μM dNTPs, 0.5 μM forward (CACATCCCTTTCAACCATGCT) and reverse (GCCAGCTGCAGGGTTTAGG) primers, fluorescence-labeled specific probe (0.2 μM) (ACACCTCTGGTTTTTGTAAAGGTGCCCACT) (Megabases, Evanston, IL), 0.625 U platinum Taq DNA polymerase (Invitrogen, Basel, Switzerland), and 5 μL cell lysate (equivalent to 50 000 cells). Amplification conditions were 1 cycle at 95°C for 5 minutes, followed by 40 cycles of amplification (95°C for 30 seconds, 60°C for 1 minute). A standard curve was made with serial dilutions of a plasmid that included a 375-bp fragment of the TRECs sequence.

F: CACATCCCTTTCAACCATGCT

R: GCCAGCTGCAGGGTTTAGG

Probe: ACACCTCTGGTTTTTGTAAAGGTGCCCACT

Quantification of TREC levels

TRECs were determined using RT–PCR using a LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) for quantification of both the characteristic signal-joint sequences harboured by TRECS and genomic porphobilinogen gene sequences (to normalize by DNA content) [15,31]. DNA was extracted from PBMC with the high pure PCR template preparation kit (Roche Diagnostics, Mannheim, Germany). RT–PCR was performed according to the manufacturer's instructions. Extracted DNA (50 ng) was amplified in a total volume of 20 µl, by using the Fast Start DNA Master Plus HybProbe (Roche Diagnostics, Mannheim, Germany) [16]. After an initial denaturation step at 95°C for 10 min, amplification was performed by 45 cycles of denaturation (95°C for 0 s), annealing (63°C for 40 s) and extension (72°C for 40 s). A standard curve was made with serial dilutions of a plasmid that included a 376-base pairs (bp) fragment of the TREC sequence, provided by Dr Lissen (University of Seville, Spain).

http://www.medicaljournals.se/acta/content/?doi=10.2340/00015555-0550&html=1

DNA was purified from CD4+ and CD8+ T cells using the Purescript kit according to manufacturer’s guidelines (Gentra Systems, Inc. Minneapolis, MA, USA). After DNA extraction samples were stored at –80ºC until TREC analyses were performed. To detect TREC a real-time quantitative PCR (RQ-PCR) method was used. The PCR was performed in a 25 µl reaction containing 1× Platinum® Quantitative PCR Supermix-UDG (Invitrogen, Carlsbad, CA, USA), 4mM MgCl2, 900 nM forward and reverse primers (300 nM for β-2-microglobulin), 200 nM probe and 5 µl isolated DNA. PCR conditions were 50ºC for 2 min, followed by 95ºC for 10 min, after which 45 cycles of amplification were carried out (95ºC for 15 s, 60ºC for 1 min). 250 ng DNA was amplified and each sample was analysed in triplicate using Rotor-Gene 2000 or Rotor-Gene 3000 from Corbett Research (New South Wales, Australia). To normalize for the input DNA, the constant gene segment of the TCRA gene Cα constant region and β2m were amplified in every DNA sample tested and expressed as TREC per 150,000 cells. The sequences of the TREC primers and probes were: forward primer: 5´-TCC CTT TCA ACC ATG CTG ACA-3´, reverse primer: 5´-TGC AAC-TCG TGA GAA CGG -3´, and probe: FAM-5´-CAC GGT GAT GCA TAG GCA CCT GC-3´-TAMRA.

Sequences of the Cα primers and probes were: forward primer: 5´-CCT GAT CCT CTT GTC CCA CAG-3´, reverse primer: 5´-GGA TTT AGA GTC TCT CAG CTG GTA CA-3´, and probe: FAM-5´-ATC CAG AAC CCT GAC CCT GCC G-3´-TAMRA. Sequence of the β2m primers and probes were: forward primer: 5´-TAA AAC TTA ATG TCT TCC TTT TTT TTC TC-3´, reverse primer: 5´-AAA CAT TTT CTC AAG GTC AAA AAC TTA-3´, and probe: FAM-5´-CCT CCA TGA TGC TGC TTA CAT GTC TC-3´-TAMRA. These three primer combinations resulted in amplicons of 129, 70 and 75 bp, respectively.

To produce a TREC standard, DNA from a pool of PBMCs from five healthy donors was amplified for 30 cycles using standard PCR conditions. The PCR product was visualized with ethidium bromide on 2% agarose gel. The amplified fragment was purified from the gel using Wizard® PCR Preps DNA Purification System (Promega, Madison, WI, USA). The agarose isolated product, corresponding to TREC, was then cloned into pGEM®-T Vector (Promega). DNA sequence analysis was performed on the isolated clone to verify that no sequence mutation was introduced during the PCR-based cloning strategy. The sequence of the primers used for generating the TREC standard was: forward primer: 5´-CCA CAT CCC TTTCAACCA-3´, reverse primer: 5´-GTG TTT TCG GCC GTG A-3´ (amplicon of 237 bp).

Old Method

DNA isolation and detection of coding joint T cell receptor excision circles Thymic output was evaluated by measuring coding joint TREC, which is generated during äRec±ØJá gene recombination. This rearrangement occurs at a frequency of approximately 69% of all ä recombination events [17]. Genomic DNA was extracted from total PBMC, CD4- or CD8-enriched T cell fractions using DNAzol reagent (GIBCO BRL, Grand Island, New York, USA), as described by the manufacturer. DNA was subsequently ampli®ed for coding joint TREC using a previously described polymerase chain reaction (PCR) enzyme-linked immunosorbent assay (ELISA) protocol [4] and stored at 4 oC until further use. Briefly, 1 and 0.5 ug genomic DNA was amplified in the presence of 200 umol/l Digoxigenin (Dig)-labeling mix (Dig-UTP and dNTP), 2 umol/l each of forward (5'-CTAATAATAAGATCCTCAAGGGTCGAGACTGTC-3') and reverse (5'-CCTGTTTGTTAAGG CACATTAGAATCTCTCACTG-3') primers, 1x PCR buffer, 2.5 mmol/l MgCl2, and 0.02 U/ul Taq polymerase (Boehringer Manheim, Indianapolis, Indiana, USA). The PCR protocol consisted of DNA denaturation at 958C for 5 min, followed by 25 cycles of amplification at 90 oC for 30 s, 60 oC for 30 s and 72oC for 30 s, and final extension step at 72oC for 7 min. Cloned coding joint TREC at various copies (500 000, 50 000, 5000 and 0) were co-amplified with each PCR to serve as standards for the assay. Precautions were taken to avoid amplicon contamination. Quantification of the coding joint TREC was performed using an ELISA, following the manufacturer's instructions with few modifications (Boehringer Manheim). Briefly, 10 ul of each amplicon was denatured in a 96-well plate using 20 ul of denaturation solution at room temperature for 10 min. Subsequently, 220 ul of hybridization solution containing 7.5 pmol/ml of a biotin-labeled internal probe (5'-TCTGTGTCTAGCACGTAGCC-3') (Fisher-Genosys, Woodlands, Texas, USA) was added. This mix was then transferred to a streptavidin-coated plate and incubated at 558C for 3 h. After extensive washing with an ELISA wash buffer, 200 ul of an anti-Dig peroxidase solution (1:100) was added to each well. The plate was then incubated at 37oC for 30 min with gentle shaking, washed and exposed to 2,2-azino-di-(3-ethylbenzthiaxoline sulfonate) (ABTS) substrate solution for 30 min at 37oC in the dark. Absorbance was read at 405 and 490 nm and a standard curve of absorbance versus copies of input standard DNA was generated using a software program (SoftMax Pro, Molecular Devices Corp., Sunnyvale, California, USA). For each PCR-ELISA reaction, the standards were ampli®ed in duplicates and the mean absorbance value was used to quantify the number of copies per microgram coding joint TREC in each of the unknown samples