In vitro transcription

Design oligo

S:

TAATACGACTCACTATAGGG ...21 bp of gene-specific region

T7-NLS-FLPe TAATACGACTCACTATAGGGATGGCCCCCAAGAAAAAGCGG 12_13_2012

T7-NLS-FLPo TAATACGACTCACTATAGGGATGGCTCCTAAGAAGAAGAGG 12_13_2012

T7-NLS-Cre 12_13_2012 TAATACGACTCACTATAGGGATGGGCCCCCCCAAGAAGAAG

AS:

Cre-Xho1-R TGTCAGCTCGAGCTAATCGCCATCTTC 2012_8_6

Flpo-Xho1-R TGCTAGCTCGAGTCAGATCCGCCTGTTGATGTAG 7_29_2013 C05

FLPe-Xho-R TAGTCGCTCGAGCTAGATCCGCCGGTTGATGTAG 12_13_2012 D09

PCR using Taq or Phusion to generate PCR

1 ul miniprep DNA template

FLPe: 2140, 2139, 2137, 2131, 2110, 2109

FLPo: 2173, 2103, 2364, 2179

using Taq polymerase. 45 cycles--> 330ng/ul

In vitro Transcription of mRNA

1. Thaw the necessary kit components, mix and pulse-spin in microfuge to collect solutions to bottom of tubes. Keep on ice.

2. If you are planning to run many reactions, it is convenient to prepare a master mix by combining equal volumes of the 10X reaction buffer and four ribonucleotide (NTP) solutions. Use 10 µl per reaction.

3. Assemble the reaction at room temperature in the following order:

Nuclease-free water X µl

10X Reaction Buffer 2 µl

ATP (100 mM) 2 µl 10 mM final

GTP (100 mM) 2 µl 10 mM final

UTP (100 mM) 2 µl 10 mM final

CTP (100 mM) 2 µl 10 mM final

Template DNA X µl 1 µg  (3 ul of 330 ng/ul)

T7 RNA Polymerase Mix 2 µl

Total reaction volume 20 µl

4. Mix thoroughly, pulse-spin in microfuge. Incubate at 37°C for 2 hours.

usually, the yield is 30 ug for Flp.

The yield will not be compromised if the incubation temperature is within the range of 35–40°C. For reaction times of 60 minutes or For reaction times of 60 minutes or less, a water bath or heating block may be used; for reaction times longer than 60 minutes, we recommend using a dry air incubator or a PCR instrument, to prevent evaporation. Figure 2 shows the time course of standard RNA synthesis from 1 μg linearized plasmid DNA templates coding for 0.3 kb, 0.8 kb and 1.8 kb RNA transcripts with the HiScribe T7 High Yield RNA Synthesis Kit. For reactions with transcripts longer than 0.3 kb, 2 hour incubation should give you the maximum yield. Figure 3 shows DNA template titrations for 0.3 kb and 1.8 kb RNA transcripts with the HiScribe T7 High Yield RNA Synthesis Kit at 37°C for 2 hours.

For reactions with short RNA transcripts (< 0.3 kb), follow the reaction set up below and incubate the reaction for 4 hours or longer. It is safe to incubate the reaction for 16 hours (overnight). Reaction set up for short transcripts (< 0.3 kb): Nuclease-free water X µl 10X Reaction Buffer 1.5 µl 0.75X final NTP 1.5 µl each 7.5 mM each final Template DNA X µl 1 µg T7 RNA Polymerase Mix 1.5 µl Total reaction volume 20 µl With this set up, the kit contains sufficient materials for 65 reactions. 

5. Optional: DNase treatment to remove DNA template. Standard reactions normally generate large amounts of RNA at concentrations up to 10 mg/ ml. As a result the reaction mixture is quite viscous. It is easier to perform DNase treatment after the reaction mixture is diluted. To remove template DNA, add 70 μl nuclease-free water, 10 μl of 10X DNase I Buffer, and 2 μl of DNase I (RNase-free), mix and incubate for 15 minutes at 37°C.

6. Proceed with purification of synthesized RNA or analysis of transcription products by gel electrophoresis.

Capped mRNA Synthesis

The recommended ratio of cap analog to GTP is 4:1. Cap analogs are sold separately.

1. Thaw the necessary kit components, mix and pulse-spin in a microfuge to collect solutions to bottom of tubes. Keep on ice.

2. Make 20 mM GTP solution by combining 2 μl of 100 mM GTP and 8 μl of nuclease-free water.

Extra 20 mM GTP can be stored at –20°C for future use.

3. Prepare cap analog at the concentration of 40 mM. 

Assemble the reaction at room temperature in the following order:

Nuclease-free water X µl 10X

Reaction Buffer 2 µl

ATP (100 mM) 2 µl 10 mM final

UTP (100 mM) 2 µl 10 mM final

CTP (100 mM) 2 µl 10 mM final

GTP (20 mM) 2 µl2 mM final

Cap Analog (40 mM) 4 µl 8 mM final

Template DNA X μl 1 µg

T7 RNA Polymerase Mix 2 µl

Total reaction volume 20 µl

5. Mix thoroughly, pulse-spin and incubate at 37°C for 2 hours

The yield per reaction is 40–50 μg RNA with approximately 80% capped RNA transcripts.

Table 1 shows the effect of varying the ratio of cap analog to GTP on the yield of RNA. Increasing the ratio of cap analog to GTP will increase the proportion of capped RNA transcripts, however it also significantly decreases the yield of the transcription reaction. A ratio of cap analog to GTP of 4:1 is preferably used.

6. Optional: To remove template DNA, add 2 μl of DNase I (RNase-free), mix and incubate at 37°C for 15 minutes.

7. Proceed with purification of synthesized RNA or analysis of transcription products by gel electrophoresis.