Promoter sequences

From ELN
Revision as of 22:26, 13 July 2018 by Paul.xu (talk | contribs) (Created page with "<parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black"> === This page contains...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

<parsererror style="display: block; white-space: pre; border: 2px solid #c77; padding: 0 1em 0 1em; margin: 1em; background-color: #fdd; color: black">

This page contains the following errors:

[edit]
error on line 1 at column 676: attributes construct error

Below is a rendering of the page up to the first error.

[edit]

</parsererror>

Promoter Sequence Example 

T7 TAATACGACTCACTATAGGGGAA


T7C4 TAATACGACTCACTATCAAGGAA taatacgactcactatcaaggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatacatatg

T7H10
Retrieved from "https://eln.excellgen.com/index.php?title=Promoter_sequences&oldid=18719"