In vitro Protein Translation

From ELN
Revision as of 15:36, 30 September 2018 by Paul.xu (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Primer Design

[edit]

5´ UTR sequence of Forward Primer (49 mer)
5´ GCGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATATG 24 bp... 3' 
3´ UTR sequence of Reverse Primer (35 mer)
5´ AAACCCCTCCGTTTAGAGAGGGGTTATGCTAGTTA  24 bp- 3´


Energy source

[edit]
Energy source Reference Cost per g Yield of active proteinmg/mL Yield/$
Maltodextrin + KH2PO4 Kim et al., 2011 $0.40 + $0.22=$0.62 1.7 2.74
Glutamate + KH2PO4 Jewett et al., 2008 $0.14 + $0.22=$0.36 0.88 2.44
Glucose + KH2PO4 Calhoun and Swartz, 2005 $0.20 + $0.22=$0.44 0.55 1.25
Maltodextrin + HMP Caschera and Noireaux, 2014 $0.40 + $1.68=$2.08 1.65 0.79
Pyruvate JewettandSwartz, 2004b $5.18 1.4 0.27
Fructose-1, 6-biphosphate Kim et al., 2007a $63.20 1.3 0.02
Glucose-6-phosphate Calhoun and Swartz, 2005 $58.20 0.7 0.013
Glucose + creatine phosphate (CP) Kim etal., 2007b $0.20 + $156=$156.2 1.5 0.0096
Creatine phosphate Kim etal., 2006 $156 1.2 0.0077
Maltose + 3-phosphoglycericacid (3-PGA) Caschera and Noireaux, 2013 $0.3 + $277=$277.3 1.9 0.0068
3-phosphoglycericacid (3-PGA) Shin andNoireaux, 2010 $277 0.75 0.0027
Phosphoenolpyruvate (PEP) Kim andSwartz, 2001 $323.50 0.75 0.0023


RTENOTITLERTENOTITLE


Cell Extract

[edit]

The E. coli crude extract was prepared as described before using a cell press to scale-up extract production (Caschera andNoireaux, 2013). The preparation of cell-free reactions was described before
(Caschera and Noireaux,2013). BL21 Rosetta2 cells were grown overnight at37oC on 2xYT agar plate with chloramphenicol and phosphates (40mM phosphate dibasic and 22mM phosphate monobasic solutions). A 5mL mini-culture,same medium composition, was carried out for 7h at 37oC. Successively 30 mL from the mini-culture was added to 60 mL of 2xYT (chloramphenicol and phosphates) and grown for 8h at 37 oC. 7 mLfrom the last culture was inoculated into 700 mL  of the 2xYT with phosphates and incubated at 37 oC until OD600 1.5–1.6 (doubling time ~ 0.5 h). Cells were harvested and washed with the S30A buffer (Caschera and Noireaux,2013)  and the lysate was prepared using a cell-press. After clarification at 30,000g the cytoplasmic extract was incubated 90 min at 37 oC to remove endogenous DNA and messenger RNAs.The extract was dialyzed at 4 oC for 1h against S30B buffer (14 mM Mg-Glutamate,150 mM K-Glutamate buffered to pH8.2 with Tris 2M) using 10 KDa molecular mass cut-off cassettes.The total protein concentration in the cellular extract (~28 mg/ml) was measured by Bradford. The cytoplasmic crude extract was 33% in volume of the cell-free reaction with a final protein concentration of ~9.2 mg/mL. The other 66% volume of the reaction was composed of water, 6 mM Mg-glutamate,60 mMK-glutamate,2% PEG-8000 (v/v), 3.5 mM of each of the 20 canonical amino acids,hexametaphosphate (at different concentrations), maltose or maltodextrinat 15 mM and 35mM respectively, and the reaction buffer(RB). The RB was prepared with the following components: 50mM Hepes pH 8, 1.5mM ATP and GTP,0.9 mM CTP and UTP, 0.2 mg/mL tRNA, 0.26 mM CoA, 0.33mM NAD,0.75 mM cAMP,0.068 mM folinic acid, and 1mM spermidine. Maltodextrin added in the reaction mixture was calculated by taking the same molecular mass of
maltose (360.31g/mol).All the chemicals listed were purchased from Sigma-Aldrich. Cell-free reactions were performed at 29 oC in 1.5mL tubes (12 ml) and protein yields measured at room temperature in  384-well plate (10 ml). Kinetics measurements of cell-free expression (5 mL) were taken at 29 oC in polypropylene 96-well plate with V-bottom shape sealed with a plastic cap to avoid evaporation. The concentration of synthesized proteins (deGFP) was determined through fluorescence measurements (Ex485nm; Em 528nm) using a multimode plate reader H1m (BioTeK). The highest yield, ~45 mM (1.14 mg/mL), was observed for 35 mM maltodextrin, 3.5mM amino acids,and a concentration of
HMP of 0.8–1.2 mM. With our previous system based on maltose or maltodextrin coupled to 3-PGA (Caschera and Noireaux, 2013), we were able to achieve ~1.4mg/mL of active protein using the same plasmid.


S30A buffer: 14 mM Mg-glutamate, 60 mM K-glutamate, 50 mM Tris buffered with acetic acid to pH 8.2.

S30B buffer 14 mM Mg-glutamate, 150 mM K-glutamate, buffered to pH 8.2 with Tris

Reaction buffer: 50 mM Hepes pH 8, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/ml tRNA, 0.26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 1 mM DTT, 2% PEG8000.

Cell-free reaction:

3% (volume) of E. coli crude extract. The other 66% of the reaction volume are composed of the plasmids and the reaction buffer containing the nutrients. The amino acid concentration was adjusted to either 1.5 mM or 3 mM of each of the 20 amino acids. Mg-glutamate and K-glutamate concentrations were adjusted according to the plasmids used (60 mM K-glutamate and 5 mM Mg-glutamate for pBEST-OR2-OR1-Pr-UTR1-deGFP-T500, 20 mM K-glutamate and 5 mM Mgglutamate for the T7 cascade). The concentration of synthesized deGFP was determined from a calibration curve (Ex 485 nm and Em 528 nm) done with pure recombinant eGFP (reGFP) purchased from Cell Biolabs Inc. End-point fluorescence was measured in a 384 format well plate using a BioTek plate reader. deGFP synthesis kinetics were measured in a 96-well plate sealed with a plastic cap to avoid evaporation. Cell-free reactions (5e15 ml) were incubated
at 29 oC.

60 mM (1.5 mg/ml) of active deGFP was produced with either 12~15 mM maltose or 25~30 mM maltodextrin added to the reactions

Solid exametaphophate (HMP, Sigma-Aldrich, NaPO3)17. )  is solved in water and kept at100 oC for 5 min before dilutions at desired concentration.

Cell-Free Reaction. Transcription and translation are performed by endogenous molecular components provided by an E. coli cytoplasmic extract, without addition of exogenous purified TX-TL enzymes. E. coli cells are grown in 2xYT medium supplemented with phosphates.70 Lysis is performed either by bead beating45,70 or with a cell-press,43 followed by the typical steps: centrifugation, recovery and preincubation of the supernatant at 37 °C for 80 min, centrifugation, dialysis of supernatant at 4 °C for 3 h, centrifugation, aliquoting the supernatant, storage at −80 °C. The extract is stable for more than a year at −80 °C. In addition to the extract, the reaction is composed of an energy mixture43 and amino acids.71 The reaction buffer is composed of 50 mM Hepes pH 8, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/mL tRNA, 0.26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 1 mM DTT, 2% PEG8000, either 10−15 mM maltose or 20−40 mM maltodextrin. A typical cell-free reaction is composed of 33% (volume) E. coli crude extract. The other 66% of the reaction volume are composed of the plasmids and the reaction buffer containing the nutrients. The amino acid concentration was adjusted between 1.5 mM and 3 mM of each of the 20 amino acids. Mg-glutamate and K-glutamate concentrations were adjusted according to the plasmids used (typically 60 mM Kglutamate and 5 mM Mg-glutamate for P70a-deGFP, 20 mM Kglutamate and 5 mM Mg glutamate for the T7 cascade). The toolbox 2.0 will be commercialized under the name “MYtxtl” by the company MYcroarray (Michigan, USA). Cell-free reactions are carried out in a volume of 5 μL to 20 μL at 29−30 °C. Semicontinuous cell-free reactions were carried out using a 96- well equilibrium dialyzer plate (Harvard Apparatus, MWCO 10 kDa), with 20 μL reaction on one side and 200 μL feeding solution on the other side. The feeding solution has a similar composition to the reaction, minus the extract and the plasmid. The plate was incubated at 29−30 °C with constant rotation (0.125 Hz), on a rotary axis.

The energy buffer is composed of 50mM Hepes pH 8, 1.5mM ATP and GTP, 0.9mM CTP and UTP, 0.2mg/ml tRNA, 0.26mMcoenzyme A, 0.33mM NAD, 0.75mM cAMP, 0.068mM folinic acid, 1mM spermidine, 30mM 3-PGA, either 10–15mM maltose or 20–40mM maltodextrin. A typical cell-free reaction is composed of 33% (v/v) of E. coli crude extract. The other 66% of the reaction volume is composed of the energy mixture, the amino acids and plasmids. The amino acid concentration was adjusted between 1.5mM and 3mM of each of the 20 amino acids. Mg-glutamate, K-glutamate and PEG8000 (polyethelyne glycol, average molecular weight of 8000) concentrations were adjusted based on the reaction test made, see text (typically 60mM K-glutamate, 5mM Mg glutamate and 2% PEG8000 for P70a-deGFP, a reference plasmid for the TXTL system (10). Cell-free reactions are carried out in a volume of 5 ml to 20ml at 29–30oC.

Hexametaphophate(HMP)solidwasdissolvedinwaterand kept at 100 1C for 5min before dilutions at desired concentration for cell-free reaction. HMP was purchased from Sigma-Aldrich with molecular weight average (NaPO3)17.

From The All E. coli TX-TL Toolbox 2.0: A Platform for Cell-Free Synthetic Biology, Vincent Noireaux, ACS Synth Biol. 2016

Cell-Free Reaction. Transcription and translation are performed by endogenous molecular components provided by an E. coli cytoplasmic extract, without addition of exogenous purified TX-TL enzymes. E. coli cells are grown in 2xYT
medium supplemented with phosphates.70 Lysis is performed either by bead beating45,70 or with a cell-press,43 followed by the typical steps: centrifugation, recovery and preincubation of the supernatant at 37 °C for 80 min, centrifugation, dialysis of supernatant at 4 °C for 3 h, centrifugation, aliquoting the supernatant, storage at −80 °C. The extract is stable for more than a year at −80 °C. In addition to the extract, the reaction is composed of an energy mixture43 and amino acids.71 The reaction buffer is composed of 50 mM Hepes pH 8, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/mL tRNA, 0.26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 1 mM DTT, 2% PEG8000, either 10−15 mM maltose or 20−40 mM maltodextrin. A typical cell-free reaction is composed of 33% (volume) E. coli crude extract. The other 66% of the reaction volume are composed of the plasmids and the reaction buffer containing the nutrients. The amino acid concentration was adjusted between 1.5 mM and 3 mM of each of the 20 amino acids. Mg-glutamate and K-glutamate concentrations were adjusted according to the plasmids used (typically 60 mM Kglutamate and 5 mM Mg-glutamate for P70a-deGFP, 20 mM Kglutamate and 5 mM Mg glutamate for the T7 cascade). The toolbox 2.0 will be commercialized under the name “MYtxtl” by the company MYcroarray (Michigan, USA). Cell-free reactions are carried out in a volume of 5 μL to 20 μL at 29−30 °C. Semicontinuous cell-free reactions were carried out using a 96- well equilibrium dialyzer plate (Harvard Apparatus, MWCO 10 kDa), with 20 μL reaction on one side and 200 μL feeding solution on the other side. The feeding solution has a similar composition to the reaction, minus the extract and the plasmid. The plate was incubated at 29−30 °C with constant rotation
(0.125 Hz), on a rotary axis.

Plasmids: http://arborbiosci.com/products/mytxtl-toolbox-2-0-plasmid-collection/

https://academic.oup.com/synbio/article/3/1/ysy001/4840637: Reactions are composed of 33% crude lysate with the remaining 67% being amino acids, salts, an energy buffer and other cofactors. A typical TXTL reaction is composed of 50 mM HEPES pH 8, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/ml tRNA, 0.26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 2% PEG8000, 10–15 mM maltose or 20–40 mM maltodextrin, 1.5–3 mM of each of the 20 amino acids, 40–120 mM K-glutamate and 2–7 mM Mg-glutamate.

 https://www.biorxiv.org/content/biorxiv/early/2017/07/28/169441.full.pdf: TXTL reactions were  composed of 33% volume crude extract and the remaining 67% volume with the following  components: energy mix, amino acid mix, cofactors, ions, and DNA. A typical TXTL reaction contains 50 mM HEPES pH 8, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/mL tRNA,  0.26 mM coenzyme A, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 1.5% PEG8000, 30 mM maltodextrin, 3 mM of each of the 20 amino acids, 90  mM K-glutamate, and 4 mM Mg-glutamate. TXTL reactions were conducted in volumes of 5 µl  at 29-30°C





PROTOCOL

[edit]

1. Crude Cell Extract Preparation

Autolysate Preparation by Freeze−Thawing.

 E. coli BL21-Gold (DE3) cells (Agilent Technologies) or the engineered E. coli BL21-Gold-dLac (DE3) cells (see above) transformed with pAD-LyseR plasmid (Figure S1 of Supporting Information) were used for autolysate production. Transformed cells were grown at 37 °C on LB/ampicillin agar plates. Starter cultures were grown overnight at 37 °C from a single colony in LB/ampicillin or 2xYT/ampicillin medium. Production cultures were grown in 2xYTPG medium (see Supplemental Experimental Procedures of Supporting Information) supplemented with ampicillin. Typically, 400 mL of 2xYTPG/ampicillin medium was inoculated with 400 μL of starter culture and grown at 37 °C on an orbital shaker at 300 rpm in a 1 L Erlenmeyer flask. Optical density of the culture (OD600: 600 nm wavelength, 1 cm path length) was measured periodically. To ensure that the measurements were performed within the spectrophotometer linear response range, the sample was diluted 5-fold with the growth medium before measurement. The cells were harvested by centrifugation for 15 min at ≈1800g at room temperature when OD600 of the 5-fold culture dilution reached 0.3. This specific harvesting density was chosen based on ref 27, which we did not optimize further. After centrifugation the supernatant was discarded, the pellet was resuspended in ≈45 mL of cold (4−10 °C) S30A buffer by vortex mixing (see Supplemental Experimental Procedures of Supporting Information), transferred to a preweighed 50 mL centrifuge tube, and centrifugated as above. The wash step can be optionally omitted to reduce the processing time, although we did not estimate the impact of its omission on autolysate quality; the wash step was included for all the preparations used in this paper. The supernatant was then carefully removed by aspiration to allow accurate measurement of the pellet weight. Typically, 1.3 g pellet was obtained from a 400 mL culture. The pellet was resuspended in two volumes (relative to the pellet weight) of cold S30A buffer supplemented with 2 mM dithiothreitol (DTT); for example, 2.6 mL of buffer was added to 1.3 g pellet. The pellet was thoroughly resuspended by vortex mixing and frozen at −80 °C. Frozen cell suspensions were thawed in a room temperature water bath, vortex mixed vigorously for 2−3 min to potentially facilitate cell lysis, and incubated at 37 °C on an orbital shaker at 300 rpm for ≈45 min. The suspensions were vortex mixed one more time and incubated as above (≈45 min, 37 °C, 300 rpm). The sample was cleared by centrifugation for 45−60 min at 30 000g at 4 °C. The 30 000g high-speed centrifugation step could be replaced by a longer centrifugation step at 21 000g using a common table-top centrifuge, as observed previously.14,15 However, the higher centrifugation speeds helped to better compact the pellet, increasing the amount of cell debris-free supernatant that could be collected; thus, the autolysates used in this paper were prepared using 30 000g centrifugation for 45 min. The supernatant was removed by pipet and cleared of any remaining cell debris by brief centrifugation (≈3−5 min) in a table-top centrifuge (we used ≈21 000g, the maximum speed of our centrifuge). Note, the pellet after either of the centrifugation steps can be loose, therefore supernatant must be pipetted out gently to avoid picking up cell debris; we recommend using clear centrifuge tubes in these steps. The lysate should be largely free of cell debris at this point; in our experience, the last centrifugation step can be safely repeated if any debris is still remaining. The lysate was split into small aliquots and frozen at −80 °C or used for cell-free expression directly. In our experience, freezing did not affect the lysate performance. For the lysate concentration experiments described in Figure 3D, ultrafiltration was performed using 3000 NMWL filter (EMD Millipore Amicon Ultra-0.5 Ultracel-3K #UFC500308).



Preparing crude cell extract over three days requires two people to conduct efficiently. The protocol functionally consists of three parts: culture growth (step 1.1 to step 1.11), cell lysis (step 1.12 to step 1.37), and extract clarification (step 1.38 to step 1.52). It is presented divided into days for convenience. Ideal extract can produce 0.75 mg/ml of deGFP from plasmid pBEST-OR2-OR1-Pr-UTR1-deGFP-T500 (Addgene #40019), and has a crude cell extract concentration between 27-30 mg/ml of protein.4 However, extract characteristics vary from batch to batch. The following recipe supplies enough for approximately 3,000 single reactions (6 ml crude cell extract). If scaling down, it is recommended to use no less than 1/6 of values given here. Due to time constraints, scaling up is not recommended.

https://www.cell.com/cell/fulltext/S0092-8674(16)31246-6: E. coli Rosetta™2(DE3) (EMD Millipore) were grown in 400 ml of LB containing chloramphenicol (34 μg/mL) and 0.1 mM IPTG at 37°C at 250 rpm. Cells were harvested in mid-exponential growth phase (OD600 ∼0.6), and cell pellets were washed three times with ice cold Buffer A containing 10 mM Tris-Acetate pH 8.2, 14 mM magnesium acetate, 60 mM potassium glutamate, and 2 mM DTT, and were flash frozen and stored at −80°C. Cell extract was prepared as described in the previous publication (Kwon and Jewett, 2015). Briefly, cell pellets were thawed and resuspended in 1 ml of Buffer A per 1 g of wet cells and sonicated in an ice-water bath. Total sonication energy to lyse cells was determined by using the sonication energy equation for BL21 Star™ (DE3), [Energy] = [Volume (μL)] – 33.6] · 1.8−1. A Q125 Sonicator (Qsonica) with 3.174 mm diameter probe at a frequency of 20 kHz was used for sonication. A 50% amplitude in 10 s on/off intervals was applied until the required input energy was met. Lysate was then centrifuged at 12,000 rcf for 10 min at 4°C, and the supernatant was incubated at 37°C at 300 rpm for 1 hr. The supernatant was centrifuged again at 12,000 rcf for 10 min at 4°C, and was flash frozen and stored at −80°C until use. Using a previously published cell-free reaction protocol (Sun et al., 2013), reaction mixtures were composed of 26.6% (v/v) of in-house lysate, 1.5 mM each amino acid except leucine (1.25 mM), 1 mM DTT, 50 mM HEPES (pH 8.0), 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/mL tRNA, 0.26 mM CoA, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 2% PEG-8000, 1 mM IPTG and 0.5% (v/v) Protector RNase Inhibitor. Optimal potassium glutamate (20-140mM) and magnesium glutamate (3-15mM) concentrations were determined for each target product. Reactions were flash-frozen in liquid nitrogen and lyophilized overnight to obtain freeze-dried pellets.


Preparation of the LoFT (lysozyme treatment, osmotic shock, and freeze-thawing) cell extract: 
Escherichia coli BL21(DE3) codon plus (RIL) (Agilent) was used throughout the study. Overnight cell cultures in LB medium were inoculated in 1 L of fresh LB medium at concentrations ranging from 0.1% to 1% v/v. Cells were cultivated with shaking (120 rpm) at 37°C. After 1 h of culture, IPTG was supplied at a final concentration of 0.1 mM to induce expression of T7 RNA polymerase encoded in DE3 under the lacUV5 promoter. Cells at OD600 = 1.0–2.0 were collected by centrifugation. The collected cells were suspended in 20 mL of 400 mM sucrose. At four time points, 50 μL of 20 mg/mL lysozyme (Nacalai Tesque, Inc., Kyoto, Japan), dissolved in 400 mM sucrose, was added to the cells suspensions (with a final lysozyme concentration of 0.2 mg/mL). Tubes were gently shaken by inversion after lysozyme addition and incubated on ice for 30 min. Next, the cells were washed twice with 20 mL of 400 mM pre-chilled sucrose. To prevent premature disruption during washing, cells were rapidly resuspended using a paintbrush rather than a pipette. The washed cells were collected by centrifugation, and dissolved in cold double distilled water (DDW). The amount of DDW varied as described in the manuscript text; however, typically 1 mL was used per g of wet cell paste. After DDW addition, the cells were rapidly transferred to 1.7 mL tubes and frozen in liquid nitrogen for 15 min or at -80°C for 1 h. Frozen cells were thawed in ice water (for approximately 1 h per mL of frozen solution). After thawing, and centrifugation at 25,000 × g for 1 h, the cell supernatants were collected as LoFT cell extracts and stored at -30°C.

The small molecules in the LoFT cell extract were exchanged with S30 buffer (5 mM Tris-HCl pH 7.6, 60 mM potassium glutamate, 14 mM magnesium acetate) using a filter unit. This process is sometimes unnecessary and was therefore only performed when needed. Briefly, 1 mL of the LoFT cell extract was transferred into an Amicon-Ultra 15 filter (10 kDa, MilliporeMerck). Next, 13 mL of the S30 buffer was added to the filter unit, which was centrifuged at 5,000 × g for 45 min (or longer) to reach a volume of less than 1.5 mL. This wash cycle was performed twice for the exchange of small molecules in the LoFT cell extract. This small molecule exchange process could be replaced with conventional dialysis using cellulose tubes.

CFPS was carried out by mixing LoFT cell extract, template DNA, and reaction mixture (50 mM Hepes-KOH pH7.6, 36 mM 3-phosphoglyceric acids, 0.5 mM of each amino acid, 90 mM potassium glutamate, 14 mM magnesium acetate, 1.5 mM each of ATP and GTP, 0.9 mM each of CTP and UTP, 20 μg/ml E. coli tRNA mixture, 68 μM folinic acid, 0.75 mM cAMP, 0.33 mM NAD+, 0.26 mM CoA, 1 mM spermidine, 12 mM maltose, 2% PEG8000, and 1 mM IPTG), in a total volume of 5 μL (except for omission assays wherein a total volume of 10 μL was used). Plasmid concentrations were 1.5 nM for genes using the T7 promoter and 10 nM for genes under control of the OR2OR1 promoter. The final concentration of the LoFT cell extract was 10 mg/mL.


Day 1

  1. Prepare bacterial culture media, culture plate, and media supplements as described in Table 1. See Supplemental Material 1 for recipes.
  2. Streak BL21-Rosetta2 strain from -80 °C onto a 2xYT+P+Cm agar plate and incubate for at least 15 hr at 37 °C or until colonies are readily visible. Note: Chloramphenicol (Cm) is used to select for a plasmid encoding rare tRNAs in the BL21-Rosetta2 strain.

Day 2

3.Prepare buffers and supplements as described in Table 2. See Supplemental Material 1 for recipes.

4. Prepare and sterilize materials required for day 3, including: 6 x 4 L Erlenmeyer flasks with aluminum foil cover (autoclaved), 4 x 1 L sterile centrifuge bottles, funnel (autoclaved), 100 g of 0.1 mm glass beads (autoclaved), 2 stir-bars (autoclaved), 1 L and 500 ml graduated cylinder (autoclaved), 2 x 1 L beakers (autoclaved), 3 ml syringe with 18 G needles (sterile), 2-3 float buoys, 2-3 10k MWCO dialysis cassettes (sterile), cuvettes.

5. Prepare mini-culture 1. Add 4 ml of 2xYT+P media and 4 μl of Cm to a 12 ml sterile culture tube and pre-warm to 37 °C for 30 min.

6. Inoculate mini-culture 1 with a colony from the 2xYT+P+Cm agar plate. Incubate at 220 rpm, 37 °C for 8 hr.

7. 7 hr and 30 min later, prepare mini-culture 2. Add 50 ml of 2xYT+P media and 50 μl of Cm to a sterile 250 ml Erlenmeyer flask and pre-warm to 37 °C for 30 min.

8. Inoculate mini-culture 2 with 100 μl of mini-culture 1 and incubate at 220 rpm, 37 °C for 8 hr.

Day 3

  1. Weigh four empty sterile 50 ml Falcon tubes and record mass in Table 3. Chill Falcon tubes on ice; these will be subsequently used in step 1.18.
  2. 7 hr and 30 min after step 1.8, prepare final bacterial culture media. Using a sterile 1 L graduated cylinder, transfer 660 ml of 2xYT+P media into each of six 4 L Erlenmeyer flasks and pre-warm to 37 °C for 30 min. Note: 4 L or larger Erlenmeyer flasks are recommended for proper aeration.
  3. Add 6.6 ml of mini-culture 2 into each 4 L Erlenmeyer flask. Incubate at 220 rpm, 37 °C until the culture reaches an OD of 1.5-2.0 at 600 nm (corresponding to mid-log growth phase). Check OD periodically with a 1:10 culture dilution for accuracy. This step should take no more than 3 hr - 3 hr 45 min; rapid growth and collection during mid-log phase is critical for extract quality.
  4. Immediately after growth, transfer all cultures evenly into four 1 L centrifuge bottles and centrifuge at 5000 x g for 12 min at 4 °C to pellet bacterial cells.
  5. While centrifuging, complete S30A buffer preparation by adding 4 ml of 1 M DTT to 2 L of previously prepared S30A. Mix and maintain buffer on ice.
  6. When centrifuging is finished, completely remove supernatant from step 1.12 by decanting and blotting the centrifuge bottles on a sterile paper towel.
  7. Add 200 ml of S30A buffer at 4 °C to each of the four centrifuge bottles, and shake the bottles vigorously until pellet is completely solubilized with no remaining clumps. Centrifuge the four bottles at 5,000 g for 12 min at 4 °C.
  8. Completely remove supernatant from previous step by decanting and blotting the centrifuge bottles on a sterile paper towel.
  9. Repeat steps 1.15 and 1.16.
  10. Add 40 ml S30A buffer at 4 °C to each centrifuge bottle. Transfer each pellet and S30A combination into a chilled Falcon tube from 1.9). Note: This step is to transfer the pellets into a smaller container.
  11. Centrifuge the Falcon tubes at 2,000 g for 8 min at 4 °C. Remove supernatant by decanting.
  12. Re-centrifuge the Falcon tubes at 2,000 g for 2 min at 4 °C. Completely remove residual supernatant by pipette. Keep on ice.
  13. Weigh the four Falcon tubes with pellet and record mass in Table 3. Calculate pellet mass, S30A buffer volume needed, and mass of beads needed based on the specific formulas in Table 3.
  14. Correct loading and bead beating of the pellet is critical to making quality extract, and is the most challenging step. It is recommended to review the video before attempting. Failure to avoid air bubbles and distribute beads evenly will result in inefficient extract.
  15. Add the amount of S30A buffer calculated in Table 3 to each Falcon tube, vortex until homogenous, and return to ice.
  16. While keeping the other Falcon tubes on ice, add beads intermittently to a single Falcon tube in three aliquots, each using 1/3 of the total beads. After addition of each aliquot of beads, vortex for 30 sec. Place Falcon tube on ice between vortex steps and after final vortex. After last aliquot is added, ensure beads are uniformly distributed. A thick paste should be formed.
  17. Prepare a 5 ml (volume) pipette tip by cutting off the end using a sterile razor blade to create a 3-4 mm opening. Dial pipette to 2 ml. Note: Different pipette sets and tips provide different amounts of suction that may not be sufficient to pull and release thick bead-cell solution; a 1 ml pipette tip with end removed can be used in lieu.
  18. Place 20 bead-beating tubes on ice.
  19. Verify high viscosity of cell-bead solution using modified pipet. It should be viscous to the point of barely exiting the pipette tip during ejection. If too viscous, re-adjust pipette tip according to step 1.25. If not viscous enough, beads can be added in increments of (pellet mass * 0.05), to a maximum mass of (pellet mass * 5.1). After each addition of beads, vortex for 30 sec and return to ice. See Figure 3afor a demonstration of viscosity.
  20. Remove bead-cell solution from Falcon tube using modified pipet, and transfer into a sterile bead-beating tube, filling it three-quarters full with bead-cell solution. Spin extremely briefly (1s) on a counter mini-centrifuge to remove air bubbles without redistributing beads. See Figures 3b-d for still images of bead-beating tube loading.
  21. Finish adding bead-cell solution to form a concave meniscus.
  22. Add a very small drop of bead-cell solution onto the inside of a bead-beating tube cap, being careful to not impede the outside lip of the cap; otherwise, the bead-beating tube will not close sufficiently. Tap the cap on a flat surface and verify that there are no air bubbles on the bottom of the cap.
  23. Cap the bead-beating tube with the bead-beating cap from the previous step. Hand to assistant for bead beating. If done correctly, the cap should be tightly sealed, no air bubbles should be visible, and little (if any) bead-cell solution should overflow. Redo the loading process if air bubbles are visible or the cap does not fully close.
  24. Vortex Falcon tube from step 1.24 with the remaining bead-cell solution to ensure even distribution of beads. Repeat steps 1.28 to 1.31 until Falcon tube is empty; then repeat steps 1.24 to 1.31 for each additional Falcon tube.
  25. Conduct steps 1.33 to 1.38 simultaneously. Have assistant take filled bead-beating tubes from 1.31 and place on ice. Once two filled bead-beating tubes have been collected and have been on ice for at least one minute, begin bead beating.
  26. Beat one tube for 30 sec at 46 rpm. Place upside down on ice for 30 sec while beating the other tube.
  27. Repeat previous step such that each filled bead-beating tube has been beat for 1 min total.
  28. Repeat steps 1.33 to 1.35 until 8 filled bead-beating tubes (or the maximum amount the centrifuge can hold) have been processed. Then, construct filter apparatus from 15 ml Falcon (Figure 3e). Add a new bead-beating cap, flat-part face up, to the bottom of a 15 ml Falcon. Then, remove cap from processed bead-beating tube and press micro-chromatography column firmly onto end of processed bead-beating tube until completely sealed. Snap off elution end of micro-chromatography column, and place micro-chromatography column, elution end down, into empty bead-beading tube. Place this complex into 15 ml Falcon. Repeat for all 8 filled bead-beating tubes; keep on ice when complete.
  29. Centrifuge 8 filter apparatuses, Falcon tube uncapped, at 6,000 g for 5 min at 4 °C to separate extract and pellet from beads.
  30. Verify each bead-beating tube has produced viable extract. Properly beat extract will not be turbid, and the pellet will have two distinct layers. Discard all turbid tubes, and transfer the supernatant from non-turbid tubes into individual 1.75 ml micro-centrifuge tubes, taking as little pellet as possible. Keep on ice until all bead-beating tubes have been processed. See Figure 3f comparing a correctly vs. incorrectly processed bead-beating tube.
  31. Centrifuge micro-centrifuge tubes from previous step at 12,000 g for 10 min at 4 °C.
  32. Transfer pellet-free supernatant into empty bead-beating tubes using a pipet, consolidating 500 μl into a new bead-beating tube.
  33. Incubate previous step, with bead-beating caps removed, at 220 rpm, 37 °C for 80 min. This step digests remaining nucleic acids using endogenous exonucleases released during the bead-beading process, and can be done by standing the bead-beating tube up in a tissue culture tube.
  34. Prepare dialysis materials. Complete S30B buffer preparation by adding 2 ml of 1 M DTT to 2 L of previously prepared S30B. Mix and add 900 ml into each of two sterile 1 L beakers. Add sterile magnetic stirrer into each beaker; keep at 4 °C.
  35. After step 1.41, extract should look turbid. Consolidate extract into 1.5 ml aliquots in 1.75 ml micro-centrifuge tubes, and centrifuge at 12000 g for 10 min at 4 °C.
  36. Using a pipet, consolidate pellet-free supernatant into 15 ml Falcon tubes on ice, and mix well by capping the tube and inverting. Save 10 μl of supernatant on ice for step 1.47.
  37. Determine total amount of extract produced, and hydrate the necessary number of 10k MWCO dialysis cassettes by submersing in S30B for 2 min, assuming 2.5 ml of extract per cassette.
  38. Load cassettes with 2.5 ml of extract. Each beaker can take up to 2 cassettes; dialyze, stirring, at 4 °C for 3 hr. Note: partial loading of cassettes is acceptable. Dialyzing increases protein production yield.
  39. During the previous step, characterize extract protein concentration with a Bradford assay, using extract saved in step 1.44. See Supplemental Material 2 for details.
  40. After dialysis is complete, aliquot extract by 1.5 ml in 1.75 ml micro-centrifuge tubes. Centrifuge at 12,000 g for 10 min at 4 °C. A pellet will form at the bottom of the tube.
  41. Consolidate clear supernatant from previous step by pipetting into a 15 ml Falcon tube on ice. Homogenize by inverting 5-10x.
  42. Based on concentration determined by Bradford in step 1.47, determine amount of extract to aliquot into individual 1.75 ml tubes. Each individual tube should have a volume with 810-900 mg of total protein. Extract should have a total protein concentration greater than 27 mg/ml. This step requires assistance to conduct expediently. Note: Aliquot extract below 30 mg/ml into 30 μl aliquots, and scale if concentration is higher; for example, aliquot extract at 28 mg/ml by 30 μl, and aliquot extract at 32 mg/ml by 28.1 μl.'
  43. Aliquot extract following step 1.50, taking care to avoid bubbles. Flash-freeze extract in liquid nitrogen. Note: Aliquots with bubbles can be removed by centrifuging at 10,000 x g for 30 sec at 4 °C.
  44. Remove tubes from liquid nitrogen using a strainer and immediately store at -80 °C. Safety: Wear protective eyewear; the caps of extract tubes may come off due to the temperature difference between liquid nitrogen and room temperature.

2. Amino Acid Solution Preparation

Amino Acid Solution should be prepared in bulk. The following recipe utilizes one full kit of RTS Amino Acid Sampler, supplying enough for approximately 11,000 single reactions. If scaling down, it is recommended to use no less than half a kit. Each amino acid in the stock is supplied at 1.5 ml, 168 mM, except for leucine at 140 mM. The final composition of Amino Acid Solution is: leucine, 5 mM, all other amino acids, 6 mM. This is 4x working concentration.

  1. Remove all 20 amino acids from -20 °C and thaw at room temperature. Once thawed, vortex until amino acids dissolve, incubating at 37 °C if necessary. After amino acids are dissolved, put all amino acids on ice except for Asn, Phe, and Cys, which are kept at room temperature. Cys may not fully dissolve.
  2. On ice, add 12 ml of sterile water to a sterile 50 ml Falcon tube.
  3. Add 1.5 ml of each amino acid in the following order, taking care to vortex the Falcon tube after each addition and to keep the solution on ice: Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Ile, Lys, Met, Phe, Pro, Ser, Thr, Val, Trp, Tyr, Leu, Cys. Cys can be added as a suspension. After addition, vortex until solution is relatively clear, incubating at 37 °C if necessary. Cys may not fully dissolve.
  4. Aliquot Amino Acid Solution into 50 tubes at 26 μl each on ice. Aliquot the rest at 500 μl per tube on ice. The 26 μl aliquots will be used for calibrating extract, while the 500 μl aliquots will be used for preparing buffer. While aliquoting, vortex the main stock frequently to avoid unequal distribution of suspension.
  5. Flash freeze aliquots in liquid nitrogen and store at -80 °C. Safety: Wear protective eyewear; the caps of extract tubes may come off due to the temperature difference between liquid nitrogen and room temperature.
  6. Optional: Conduct an activity assay of newly-made Amino Acid Solution against previously made Amino Acid Solutions.

3. Energy Solution Preparation

Energy Solution is used both for calibrating crude cell extract and for creating buffer, and should be prepared in bulk. The following recipe supplies enough for approximately 10000 single reactions. If scaling down, it is recommended to use no less than 1/24 of values given here. As the Energy Solution is a significant monetary cost, first time users may want to prepare at 1/24 scale. The final composition of Energy Solution is: HEPES pH 8 700 mM, ATP 21 mM, GTP 21 mM, CTP 12.6 mM, UTP 12.6 mM, tRNA 2.8 mg/ml, CoA 3.64 mM, NAD 4.62 mM, cAMP 10.5 mM, folinic Acid 0.95 mM, Spermidine 14 mM, 3-PGA 420 mM. This is 14x working concentration. If desired, each individual item in Table 4can be stored at -80 °C for later use.

  1. Remove all chemicals in Table 4 from -80 °C, -20 °C, or 4 °C to room temperature for 30 min.
  2. Prepare stock solutions as described in Table 4. See Supplemental Material 1 for recipes. Place all solutions on ice after preparation.
  3. In a 15 ml Falcon tube, add in the following order, taking care to vortex the Falcon tube after each addition and to keep the solutions on ice: 3.6 ml 2 M HEPES, 144 μl water, 1.39 ml nucleotide mix, 576 μl 50 mg/ml tRNA, 576 μl 65 mM CoA, 276 μl 175 mM NAD, 170 μl 650 mM cAMP, 288 μl 33.9 mM Folinic acid, 144 μl 1 M spermidine, and 3.09 ml 1.4 M 3-PGA.
  4. Aliquot Energy Solution into 50 tubes at 7 μl each on ice. Aliquot the rest at 150 μl per tube on ice. The 7 μl aliquots will be used for calibrating extract, while the 150 μl aliquots will be used for preparing buffer. While aliquoting, vortex the main stock frequently.
  5. Flash freeze aliquots in liquid nitrogen and store at -80 °C. Safety: Wear protective eyewear; the caps of extract tubes may come off due to the temperature difference between liquid nitrogen and room temperature.
  6. Optional: Conduct an activity assay of newly made Energy Solution against previously made Energy Solutions.

4. Buffer Preparation

Buffer Preparation requires the completion of Crude Cell Extract Preparation, Amino Acid Solution Preparation, and Energy Solution Preparation. Each buffer is unique to a batch of crude cell extract. Mg-glutamate, K-glutamate, and DTT (in that order) are optimized in this section to produce reactions with maximum levels of expression. The following protocol utilizes a pre-written template, TXTL_e(template)_calibration_JoVE.xlsx (Supplemental Material 3), to calibrate pre-prepared crude cell extract and prepare buffer. However, one can also calibrate crude cell extract and prepare buffer without the template by optimizing Mg-glutamate, K-glutamate, and DTT manually and setting up buffer such that along with extract, it is 75% of a total reaction volume. If calibrating manually, final reaction conditions can be found in step 5.

  1. Complete the "General Data" form.
  2. Thaw on ice 100 mM Mg-glutamate (4 °C), 3 M K-glutamate (4 °C), 6 mM Amino Acid Solution (26 μl, -80 °C), Energy Solution (7 μl, -80 °C), 100 mM DTT (-20 °C), positive control DNA (-20 °C), 40% PEG-8000 (4 °C), crude cell extract (-80 °C), and water (4 °C). Note: Use 1 nM working concentration pBEST-OR2-OR1-Pr-UTR1-deGFP-T500 (Addgene plasmid 40019) for the positive control (excitation 485 nm, emission 525 nm), or another reference which produces high signal intensity.4
  3. Prepare seven 10.5 μl reactions, testing a range of 4-10 mM additional Mg-glutamate, by aliquoting set amounts of stock Mg-glutamate into individual micro-centrifuge tubes. Note: Although 10.5 μl reactions are initially prepared, the final reaction is 10 μl.
  4. Prepare master mix as indicated in the template under "Mg-glutamate calibration," adding an extra 80 mM of K-glutamate. Keep on ice and vortex after the addition of each item. Note: The values given here and in the template are in addition to the amounts of Mg-glutamate, K-glutamate, and DTT present in the S30B buffer used to make crude cell extract.
  5. Add master mix to samples containing Mg-glutamate and prepare reactions. See steps 5.10 to 5.13 for detailed instructions.
  6. Run reaction at 29 °C, either in an incubator or a plate reader.
  7. Determine optimum Mg-glutamate concentration by end-expression level and maximal rate of protein expression (Figure 4a). Note: Runtimes vary depending on experiment but typically last under 8 hr.
  8. Repeat steps 4.2 to 4.7 for K-glutamate under "K-glutamate calibration," setting Mg-glutamate levels to those found in step 4.7.
  9. Repeat steps 4.2 to 4.7 for DTT under "DTT calibration," setting Mg-glutamate levels to those found in step 4.7 and K-glutamate levels to those found in step 4.8. Note: We have found that added DTT does not significantly affect end-expression levels.
  10. Use values found in calibration under "Buffer composition" to determine the composition of buffer to be prepared. Based on the amount of crude cell extract produced, a master mix recipe is produced for a set amount of buffers.
  11. Thaw aliquots as listed in master mix recipe on ice. Once thawed, prepare master mix, keeping on ice and vortexing after the addition of each item.
  12. Aliquot by amount stated under "Buffer composition." Flash-freeze buffer tubes in liquid nitrogen. While aliquoting, vortex the main stock frequently.
  13. Remove tubes from liquid nitrogen using a strainer and immediately store at -80 °C. Safety: Wear protective eyewear; the caps of extract tubes may come off due to the temperature difference between liquid nitrogen and room temperature.

5. Experimental Execution of a TX-TL Reaction

Final reaction conditions are: 8.9-9.9 mg/ml protein (from crude extract), 4.5 mM-10.5 mM Mg-glutamate, 40-160 mM K-glutamate, 0.33-3.33 mM DTT, 1.5 mM each amino acid except leucine, 1.25 mM leucine, 50 mM HEPES, 1.5 mM ATP and GTP, 0.9 mM CTP and UTP, 0.2 mg/ml tRNA, 0.26 mM CoA, 0.33 mM NAD, 0.75 mM cAMP, 0.068 mM folinic acid, 1 mM spermidine, 30 mM 3-PGA, 2% PEG-8000. A basic TX-TL reaction has 3 parts (tubes): crude cell extract, buffer, and DNA. The ratio is: 75% buffer and extract, 25% DNA. Reactions can vary in volume, and we use 10 μl by convention to minimize reaction volume and enable running in a 384-well plate. Larger volumes require agitation for proper oxygenation. The following protocol utilizes a pre-written template, TXTL_JoVE.xlsx (Supplemental Material 4), to conduct a 10 μl reaction. Items in purple indicate user-input values, and items in blue indicate additional reagents to add to the reaction. However, one can also conduct a reaction without the template by following reaction conditions outlined above.

  1. Complete the "General Data" form.
  2. Under "Master Mix Preparation," insert the extract percentage value from step 4.1 into the purple box.
  3. Design your experiment in silico using the "Master Mix Preparation" (rows 10-17) and "DNA Preparation" (rows 19-50) sections. Generally, constants can be put into the "Master Mix Preparation" section, while variables can be put into the "DNA Preparation" section. Minimize samples per experiment to avoid sample evaporation and experimental start time bias. See Figure 6 for a sample setup.
  4. Under "Master Mix Preparation," add reagents such as inducers or proteins, which will go in all samples at a constant concentration. Starting with row 14, fill out the blue shaded areas, keeping one reagent to each line. Units are relative ratios.
  5. Under "DNA Preparation," add DNA which will be sample specific. Sample IDs #1 and #2 correspond to positive and negative controls, respectively. Sample IDs #3 and above are user-modifiable for DNA, stock concentration in ng/μl, length in base pairs, desired final concentration in nM, and repeats (of 10 μl reactions). The amount of stock DNA to reach desired final concentration is automatically calculated. The total across the row sums to 10.5*n, where n is the number of repeats. Note: Although the final reaction volume is 10 μl, the calculations assume a total volume of 10.5 μl per reaction, to account for volume lost during pipetting.
  6. Under "DNA Preparation," add reagents or additional DNA which will be sample specific to blue columns. Stock DNA concentrations in nM can be calculated under "DNA Preparation," while sample specific reagents require manual calculation based on a total reaction volume of 10.5*n. The entered volumes are subtracted out of the water volume of the same row.
  7. Remove needed number of tubes of buffer, crude cell extract, and positive control under "Tubes to thaw," from -20 °C or -80 °C and thaw on ice.
  8. Prepare DNA samples. For each sample ID, aliquot out the indicated DNA, water, and user-supplied items per the "DNA Preparation" section into a micro-centrifuge tube, at room temperature. Note: to avoid sample loss, recently calibrated pipets and low-stick pipette tips and micro-centrifuge tubes are recommended.

When tubes from step 5.7 are thawed, prepare the master mix consisting of buffer, extract, and any global user-supplied items based on the orange-shaded boxes, keeping on ice and vortexing after the addition of each item. Note: Extract is extremely viscous. Aliquots with bubbles can be removed by centrifuging at 10,000 x g for 30 sec at 4 °C.

  1. Add the amount of master mix indicated in the orange cells under "DNA Preparation" (column O) to each DNA sample, and keep at room temperature. Treat this as the reaction start time.
  2. Vortex each sample, and centrifuge at 10,000 x g for 30 sec at room temperature to bring down any residual sample and to reduce bubbles.
  3. If conducting reaction in micro-centrifuge tubes, incubate directly at 29 °C. Otherwise, pipette 10 μl of sample into a 384-well plate. Note: Reactions in volumes greater than 10 μl may require agitation for oxygenation.
  4. Centrifuge plate at 4,000 x g for 30 sec at room temperature to bring down any residual sample and to reduce bubbles. Seal plate afterwards to prevent evaporation.
  5. Run reaction at 29 °C. Note: Runtimes vary depending on experiment but typically last under 8 hr.'

We have presented a five day protocol for the preparation of an endogenous Escherichia coli based TX-TL cell-free expression system. A sample timeline for creating the reagents - crude cell extract and buffer - can be found in Figure 1. Once created, these can be stored at -80 °C for up to one year. After reagents are created, experimental setup and execution can be done in less than 8 hr. In addition, we optimized the expression conditions of the TX-TL cell-free expression system. Other user-supplied additions, such as buffers or DNA solutions, should be calibrated for toxicity beforehand. For example, different methods of processing plasmids result in different expression due to salt content. We also tested the effect of Tris-Cl elution buffer on reaction efficiency (Figure 5). An example of crude cell extract calibration, referring step 4.1 to 4.9, is shown in Figure 4a. In general, our experiments show that the crude cell extract is most sensitive to Mg-glutamate levels, followed by K-glutamate levels. To demonstrate the cell-free expression system, we constructed and tested a negative feedback loop based on tet repression.26 (Figure 6). In the cell-free expression system, the same circuit run with and without aTc shows a 7-fold end-point expression change of deGFP reporter after eight hours of expression. Although this experiment does not require global inducers or repressors, if necessary they can be added under "Master Mix Preparation."

Name Concentration Amount Sterilization Notes
Chloramphenicol (Cm) 34 mg/ml in ethanol 1 ml Filter sterilize (0.22 μM) Can be made in larger volumes stored at -20 °C for later use.
2xYT+P+Cm agar plate 31 g/L 2xYT, 40 mM potassium phosphate dibasic, 22 mM potassium phosphate monobasic, 34 μg/ml chloramphenicol 1 plate Autoclave  
2xYT+P media 31 g/L 2xYT, 40 mM potassium phosphate dibasic, 22 mM potassium phosphate monobasic 4 L Autoclave  

Table 1. Reagents for day 1 of Crude Cell Extract protocol.

Name Concentration Amount Sterilization Notes
Tris base 2 M 250 ml Filter sterilize (0.22 μM) or autoclave Can be stored at room temperature.
DTT 1 M 6 ml Filter sterilize (0.22 μM) Can be made in larger volumes and stored at -20 °C for later use.
S30A buffer 14 mM Mg-glutamate, 60 mM K-glutamate, 50 mM Tris, pH 7.7 2 L Autoclave To reach pH 7.7, titrate with acetic acid. Add DTT to 2 mM final concentration just before use. Store at 4 °C.
S30B buffer 14 mM Mg-glutamate, 60 mM K-glutamate, ~5 mM Tris, pH 8.2 2 L Autoclave To reach pH 8.2, titrate with 2M Tris. Add DTT to 1 mM final concentration just before use. Store at 4 °C.

Table 2. Reagents for day 2 of Crude Cell Extract protocol.

  Falcon
  1 2 3 4
Empty 50 ml Falcon (g)        
50 ml Falcon with pellet (g)        
Pellet mass (50 ml Falcon with pellet - empty 50 ml Falcon) (g)        
S30A buffer volume to add (pellet mass* 0.9) (ml)        
Total mass of beads to add (pellet mass * 5.0) (g)        

Table 3. S30A buffer and bead mass calculator, for day 3 of Crude Cell Extract protocol.

Name Concentration Amount Sterilization Notes
HEPES 2 M, pH 8 4 ml None To reach pH 8, titrate with KOH.
Nucleotide Mix 156 mM ATP and GTP, 94 mM CTP and UTP, pH 7.5 1.5 ml None To reach pH 7.5, titrate with KOH.
tRNA 50 mg/ml 600 μl None  
CoA 65 mM 600 μl None  
NAD 175 mM, pH 7.5-8 300 μl None To reach pH 7.5-8, titrate with Tris at 2 M.
cAMP 650 mM, pH 8 200 μl None To reach pH 8, titrate with Tris at 2 M.
Folinic Acid 33.9 mM 300 μl None Although only 300 μl is needed, recipe in supplemental is for 1.15 ml.
Spermidine 1 M 150 μl None Store at 4 °C, heat to 37 °C to melt.
3-PGA 1.4 M, pH 7.5 3.2 ml None To reach pH 7.5, titrate with Tris at 2 M.

Table 4. Reagents to prepare for Energy Solution protocol.





Supplemental Material 1. Recipes for Items.

Chloramphenicol, 34 mg/ml: Prepare 0.51 g chloramphenicol and add ethanol to 15 ml. Filter sterilize (0.22 μM), aliquot to 1 ml tubes, store at -20 °C for later use.

2xYT+P+Cm agar plate: Prepare 1.24 g 2xYT, 1.6 ml potassium phosphate dibasic solution @ 1 M, 0.88 ml potassium phosphate monobasic solution @ 1 M, 0.6 g agar, and water to 40 ml. Autoclave. Let cool to 50 °C and add 40 μl Cm. Aliquot 25 ml into a 100 x 15 mm Petri dish, and let cool for an hour.

2xYT+P media: Prepare 124 g 2xYT, 160 ml potassium phosphate dibasic solution @1 M, 88 ml potassium phosphate monobasic solution @ 1 M, and water to 4 L. Aliquot out into 2 x 1.88 L and 0.24 L. Autoclave.

Tris base, 2 M: Prepare 60.57 g Tris base and water to 250 ml. Sterilize, store at RT for later use.

DTT, 1 M: Prepare 2.31 g DTT and water to 15 ml. Filter sterilize (0.22 μM), aliquot to 1 ml tubes, store at -20 °C for later use.

S30A buffer: Prepare 10.88 g Mg-glutamate and 24.39 g K-glutamate, 50 ml Tris at 2M, acetic acid (to pH 7.7), and water to 2 L. Autoclave, store at 4 °C, add 4 ml 1 M DTT before use.

S30B buffer: Prepare 10.88 g Mg-glutamate and 24.39 g K-glutamate, Tris at 2 M (to pH 8.2), and water to 2 L. Autoclave, store at 4 °C, add 2 ml 1 M DTT before use.

HEPES: Prepare 1.91 g HEPES (MW 238.21), KOH (to pH 8), and water to 4 ml.

tRNA: Prepare 30 mg of tRNA and water to 600 μl.

CoA: Prepare 30 mg of CoA (MW 767.53) and water to 600 μl.

NAD: Add 34.83 mg of NAD (MW 663.43), Tris at 2 M (to pH 7.5-8), and water to 300 μl. (Add 27 μl of Tris at 2 M to bring the solution to pH 7.5-8).

cAMP: Add 42.80 mg of cAMP (MW 329.22), Tris at 2 M (to pH 8), and water to 200 μl. (Add 73 μl of Tris at 2 M to bring the solution to pH 8).

Folinic Acid (33.9 mM): To 20 mg of solid folinic acid calcium salt (MW 511.5), add 1.15 ml water.

Spermidine: Prepare 23.55 μl of spermidine (MW 145.25) and water to 150 μl. Prepare at room temperature after melting briefly at 37 °C.
3-PGA: Add 1.03 g of 3-PGA (MW 230.02), Tris at 2 M (to pH 7.5), and water to 3.2 ml. (Add 1.73 ml of Tris at 2 M to bring the solution to pH 7.5).

Nucleotide Mix: Add 145 mg of ATP dipotassium salt dihydrate (MW 619.4), 133 mg of GTP disodium salt (MW 567.14), 79.4 mg of CTP disodium salt dihydrate (MW 563.16), 82.6 mg of UTP trisodium salt dihydrate (MW 586.12), KOH at 15% dilution (to pH 7.5), and water to 1.5 ml. (Add 353 μl of KOH at 15% dilution to bring the solution to pH 7.5).

Supplemental Material 2. Bradford Assay.

   1. Remove Bradford agent from 4 °C and set at room temperature.
   2. Prepare 50 μl BSA Standard at 1 mg/ml and at 0.1 mg/ml.
   3. Prepare 40 μl 20x dilution of extract from step 1.47.
   4. Add 800 μl water to 7 cuvettes.
   5. Prepare standard cuvettes for 0 mg/ml, 1 mg/ml (10 μl 0.1 mg/ml BSA), 2 mg/ml (20 μl 0.1 mg/ml BSA), 4 mg/ml (4 μl 1 mg/ml BSA), 6 mg/ml (6 μl 1 mg/ml BSA).
   6. Prepare experimental cuvettes for 2 μl of sample and 4 μl of sample.
   7. Add 200 μl of Bradford agent to each cuvette and mix well by pipetting. Incubate at room temperature for at least 10 min.
   8. Produce standard curve at OD 595 nm using cuvettes from step 6.5. Reject standard curve if r2 < 0.95.
   9. Determine extract concentration at OD 595 nm using cuvettes from step 6.6

Retrieved from "https://eln.excellgen.com/index.php?title=In_vitro_Protein_Translation&oldid=19337"