Expression of Toxic Protein using pBad Promoter

The pBAD promoter exhibits an almost all-or-none behaviour upon induction with arabinose when located on a high copy vector, but allows for gradual induction when cloned into a low copy vector. Thus, it was evident that this promoter on a high copy vector would be inappropriate for tightly regulated gene expression. Based on these findings, a low copy vector was used to investigate the ability to inhibit gene expression subsequent to induction of pBAD.

Use M9 minimal medium supplemented with 0.2% glycerol .

Do not use glucose in the medium as it inhibits protein expression

upstream sequence

AACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCC

WT

ACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGC ATTTTTA TCCATAAGATTAGCGGATCCTAC
CTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACC(C)GTTTTTTTGGGCTAGC AGGAG 

K206000

ACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGC AAGATAG TCCATAAGATTAGCGGATCCTAC
CTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACC   GTTTTTTTGGGCTAGC AGGAG 

 K206000 is a variant pBAD promoter with a modified AraI1 site that has been shown  both to be responsive to lower concentrations of arabinose and to exhibit a higher maximum expression 

Induction

Transform E. coli DH5a/with pLysN

Innoculate  a colony in 100 ml LB medium grown in LB with ampicillin at 100 μg/mL at 37 °C for over night.

Split into 8 L  of 2 X YT medium or LB with Amp

After 3 hours, the OD600 of the culture is around 0.6 at 37 °C.

Add 0.02% L-arabinose,  13 mM (not D-arabinose) and incubate at  37 oC for 3 hours or 18 °C for over night.

In 2010, China produced about 500 tons of L-arabinose at the cost of more than 70 USD per kg. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3125199/

Fermentation was carried out in a 5L bioreactor (Sartorius, Germany) to achieve high levels of rhGH expression. The fermentation was carried in 2.5 L medium in a batch mode. The medium comprised of yeast extract (3.6%), tryptone (1.8%), (NH4)2SO4 (0.13%), NaH2PO4 (0.3%), Na2HPO4 (0.4%), KCl (0.067%), MgSO4 (0.05%), glycerol (1.5%) and ampicillin (100 µg/ml). 

The fermentation medium was inoculated with overnight seed culture at 10% v/v. Aeration was kept at 1 vvm (volume of air / volume of fermentation medium / minute) and the temperature maintained at 37°C by PID controller of the instrument. While the agitation was set between 300 to 800 rpm, the dissolved oxygen level was maintained at 30% by automatic addition of pure oxygen to air, which was controlled by mass flow controller of the instrument. The fermentation was carried out at pH 7.00 that was maintained by the automatic addition of either 30% H3 PO3 or 12% NH4OH and foaming controlled by addition of 0.05% antifoam US 1510 (Dow Corning, USA). The growing culture was induced at OD600 of 10 to 15 by the addition of 13 mM L+ arabinose. The biomass achieved at the end of five hours post-induction was measured by estimating wet cell weight (WCW) per liter of a fermentation medium. For estimating WCW, 10 ml of the fermentation broth was taken in pre-weighed centrifuge tube (C) in triplicates and spun at 7000 g for 10 minutes. The supernatant was discarded and the tubes were wiped dry and weight of each tube was measured (T). The difference between T and C constituted the WCWSee  Arabinose_Induction