164 pT7A3-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H

PCR fragment 1 from 2369 pT7A3-lc-MBP-(TEV)
2094-T
CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATAT
    TTTATTAAAACAAATTGAAATTCTTCCTCTATATAGTAC

MBP-seq-R (CGGTTCTTGCAGGTTGAAC)
gttcaacctgcaagaaccg

PCR fragment 2 from 2369 pT7A3-lc-MBP-(TEV)

pET-seq-F2  ATCTCGACGCTCTCCCTTATG
2094-B
CATGATATATCTCCTTCTTAAAGTTAAACAAAATTATTT

Purify on gel, PCR again 
pET-seq-F2  ATCTCGACGCTCTCCCTTATG
MBP-seq-R (CGGTTCTTGCAGGTTGAAC)
gttcaacctgcaagaaccg

Digest with BsaI + SphI
clone into  BsaI + SphI 162 pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H

sequencing data: no T7A3 promoter. It is pCold promoter.. So it is clone # 162. 

​

http://www.excellgen.net/eln/images/2/2c/163_164_digestion.JPG

Redo

above methods were not working. use this method:

subcloning from 162 pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H 
to 163 pT7A3-MBP-(Tev)-GST-(3C)-sfGFP
using Nco1+ Xho1

insert: 162

Vector: 163-2, #3

enzymes: NcoI+ Xho1

miniprep digestion

1/4/19

Expression

1/9/19

Transform Nico21(DE3)pLysN, grow on LB/KC at 37 oC O/N, Wash coloines with LB/KC medium and make glycerol stock.

Grow cells in 15 ml 2XYT, induce with 1 mM IPTG or 0.1% L-arabinose when OD600 reaches ~0.8.

For 162, cool culture on ice for 10 min, Add 1 mM IPTG and induce for 2 hours or overnight, keep culture cool using blue ice pad.

Induce either at -18 oC (blue ice pad) for 162, or room temperature for 164, 169, 170, for 2 hours or overnight

Spin down cells, wash with ddH2O, Add lysis buffer and store at -80 oC freezer o/n

Lyse cells by freeze-thaw 3 time. Add 2 ul DNase.

Spin, transfer supernatant to another clean tube (as soluble fraction).

To pellet, add buffer with 0.1% SDS, 4 M Urea, 50% Buffer A.

Add 25 ul Ni beads

Binding by rotary for 30 min

Spin and remove supernatant, wash 3~5 times buffer A

Add 25 ul  Buffer B. Spin, collect 25 ul euluate.

Add 8 ul 4X SDS-PAGE Loading buffer, Boil 10 min.

Run 4~20% SDS-PAGE

 pI/Mw: 8.69 / 123.9

Well #	Clone ID	Name	Induction time, condition	Smaple	Expression
M		PageRuler Plus
1	162	pCold-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H	2 h, 16 oC	sup
2	162		2 h, 16 oC	pellet	y, IB
3	162		o/n, 16~23 oC	sup
4	162		o/n, 16~23 oC	pellet	y, IB
5	164	pT7A3-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H	2 h, 37 oC	sup
6	164		2 h, 37 oC	pellet	y, IB
7	164		o/n, 25 oC	sup
8	164		o/n, 25 oC	pellet	y, IB
9	169	pBad-MBP-(Tev)-GST-(3C)-Tat-NLS-iFLP-6H	2 h, 37 oC	sup
10	169		2 h, 37 oC	pellet	y, IB
11	169		o/n, 25 oC	sup
12	169		o/n, 25 oC	pellet	y, IB
13	170	pT7-MBP-(tev)-GST-(3c)-Tat-NLS-iFLP-6H	2 h, 37 oC	sup
14	170		2 h, 37 oC	pellet	y, IB
15	170		o/n, 25 oC	sup
16	170		o/n, 25 oC	pellet	y, IB
MB		Biorad protein marker

Conclusion: Tat-Flp in pCold,  induction for 2 hours,  is the best for expression. But still not soluble.