VLP as Antigen

AP205

QBeta

5’-GTGG

AGATCT

T7 promoter

TAATACGACTCACTATAGGG

Qβ RNA hairpin (Qbeta pac signal)
AAATGCATGTCTAAGACAGCATCTTCGCG

targeting sequence

CAACATTCTGGGACACAAATTG

miR-30b GFP

CTGTGAAGCCACAGATGGG

targeting sequence complement

CAATTTGTGTCCCAGAATGTTG

TGC

T7 terminator

CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

CTCGAG

GGTG-3

The native infectious Qβ virion displays 3–5 copies of a large (approximately 200 amino acids) domain extension at the C-terminus, termed the A1 protein, which is used to recognize the E. coli host

The number of incorporated extensions varied inversely with their length, from a minimum of 10 per particle for a modified version of the full-length A1 protein to a maximum of 81 per particle for extensions of 11–24 amino acids derived from the A1 sequence

Function, structure, and production of the most commonly used protein-based nanoparticles (PNPs).

PNP	Native Organism	Biological Function	Geometry	Number of Subunits	Size (Diameter)	Heterologous Production
Virus-like particles (VLPs)
CCMV 1	Cowpea chlorotic mottle virus capsid protein	Plant virus	Icosahedral	182	28 nm	Plants; yeast; Escherichia coli; Pseudomonas fluorescens
CPMV 2	Cowpea mosaic virus capsid protein	Plant virus	Pseudo icosahedral	120 Large (L) and 120 Small (S)	28 nm	Insect cells; plants
HBc 3	Hepatitis B virus capsid protein	Human virus	Icosahedral	180 or 240	30 nm or 34 nm	Mammalian cells; insect cells; plants; yeast; E. coli; cell-free
MS2	Enterobacteriaceae	Bacteriophage	Icosahedral	180	26 nm	Yeast; E. coli; cell-free
P22	Salmonella typhimurium	Bacteriophage	Icosahedral	420	60 nm	E. coli
Qbeta	E. coli	Bacteriophage	Icosahedral	180	28 nm	Yeast; E. coli; cell-free
Non-viral PNPs
Dps 4(mini-ferritin)	Archaea; Bacteria (e.g., Listeria innocua)	Involved in oxidative and starvation responses	Tetrahedral	12	9 nm	E. coli
E2	Bacillus stearothermophilus	Core of the pyruvate dehydrogenase multienzyme complex	Dodecahedral	60	24 nm	E. coli
Encapsulin	Archaea; Bacteria	Involved in oxidative stress response	Icosahedral	60 or 180	20~40 nm	Mammalian cells; yeast; E. coli
Ferritin (maxi-ferritin)	Archaea; Bacteria; Eukarya	Iron storage	Octahedral	24	12 nm	Mammalian cells; insect cells; yeast; E. coli
Hsp 5	Archaea; Bacteria; Eukarya (e.g., Methanococcus jannaschii)	Chaperone	Octahedral	24	12 nm	E. coli
Lumazine synthase	Archaea; Bacteria; Eukarya (e.g., Aquifex aeolicus)	Mediates the biosynthesis of riboflavin	Icosahedral	60	15.4 nm	E. coli
Vault protein	Eukarya	Involved in signaling and immune responses	39-fold dihedral	78 Major vault protein	Diameter: 40 nm Length: 67 nm	Insect cells; cell-free

1 Cowpea chlorotic mottle virus, 2 Cowpea mosaic virus, 3 Hepatitis virus, 4 DNA-binding proteins from starved cells, 5 Heat shock proteins.

Table 2. Methods used to bioengineer the most commonly used PNPs for a range of bioapplications.

	PNP	In Vitro Loading Mechanism	Cov Biocon 1	Point Mut 2	UAA 3	Pep Disp 4	Prot Disp 5	Modul Assem 6	Encapsulated Cargo			Applications
									Diffusion 7	In Vitro	In Vivo
VLPs	CCMV	pH; Ionic strength	*	*		*	*			Metals; small-molecule drugs; nucleic acids; organic polymers		Drug delivery; vaccines; bioimaging; prodrug activation; biocatalysis
	CPMV		*	*		*	*		Metals; fluorescent probes; biotin; organic polymers			Drug delivery; vaccines; bioimaging
	HBc	Denaturants	*	*	*	*	*	*		Metals; small-molecule drugs; fluorescent probes; nucleic acids		Drug delivery; vaccines; bioimaging
	MS2	pH; Denaturants	*	*	*	*	*		Fluorescent probes; photosensitizers	Metals; small-molecule drugs; nucleic acids	Proteins	Drug delivery; vaccines; bioimaging; biocatalysis
	P22	pH	*	*		*		*	Metals; fluorescent probes; biotin; organometallic polymers	Proteins	Proteins; peptides; epitopes; nucleic acids	Drug delivery; vaccines; nanomaterial synthesis; biocatalysis; solubility enhancement
	Qβ	pH; Denaturants	*	*	*	*	*		Fluorescent probes; cationic polymers	Metals; small-molecule drugs; fluorescent probes; nucleic acids	Proteins	Drug delivery; vaccines; bioimaging; nanomaterial synthesis
Non-viral PNP	Dps		*			*		*	Metals			Drug delivery; nanomaterial synthesis
	E2	Denaturants	*	*		*	*	*	Small-molecule drugs; fluorescent probes	Nucleic acids		Drug delivery; vaccines; biocatalysis; antibody purification
	Encapsulin	pH; Denaturants	*	*		*	*		Metals	Proteins	Proteins	Drug delivery; bioimaging; immunotherapy; antimicrobials; biocatalysis
	Ferritin	pH	*	*	*	*		*	Metals; small-molecule drugs	Bioactive compounds; metals; small-molecule drugs	Metals	Solubility enhancement; drug delivery; vaccines; bioimaging; immunotherapy; nanomaterial synthesis
	Hsp	Temperature	*	*		*	*		Metals	Metals; small-molecule drugs; dyes; fluorescent probes		Drug delivery; nanomaterial synthesis; biocatalysis
	LS	Ionic strength	*	*		*	*	*		Proteins		Drug delivery; vaccines; bioimaging; biocatalysis
	Vault	“Breathing mechanism”	*			*				Metals; proteins; epitopes; antigens	Proteins	Solubility enhancement; drug delivery; vaccines; bioimaging; immunotherapy; bioremediation

¹ Covalent bioconjugation; ² Point Mutation; ³ Unnatural amino acid incorporation; ⁴ Peptide display; ⁵ Whole protein display; ⁶ Modular assembly; ⁷ Pore-mediated diffusion