1248 pET8XHis-DeepVent-Exo
Cloning of pET8XHis-DeepVent-Exo
[edit]Purpose: Cloning of pET8XHis-DeepVent-Exo
Date: June 22, 2012
Notebook:
Page:
Clone ID: 1248
Experimenters: Jennifer Truong
Results
[edit]Cloning
[edit]Date: June 22, 2012
Amplified sequence with KAPA (see lane 2), expected size 598 bp
Cut out band for DNA purifaction and digested with Nde1 and Nco1with pET8XHis (286)
Digested with Nde1 and Nco1with pET8XHis (286), need to redigest vector
May have accidentally switched samples, reamplified sequence
Cut out band in lane 2 (expected size = 600 bp), placed in tube in gel, will purify and digest on Monday
Date: June 25, 2012
Digested 1248 with Vector 286 (pET 8X-His) with Ndel and Ncol
See lanes 5 and 6, cut out the bands, purified and ligated
Date: June 27, 2012
Was not successfullly cloned, may be because of the very weak vector band, or did not ligate/digest long enough (see lane 6)
Reamplified DNA, see lane 2
Cut out band, purified DNA and digested with with Vector 286 (pET 8X-His) with Ndel and Ncol
See lanes 4 and 5. Cut out insert from lane 4, and cut out vector band in lane 5. Purified and ligated together. Transformed with Top10 cells, plated on KAN resistant plates, grow overnight.
Date: July 10, 2012
Amplified sequence see lane 2 expected size 598 bp
Cut out band for DNA purifaction and digested with Nde1 and Nco1with pET8XHis (286)
DNA digestion did not show up (see lane 3), maybe because DNA amplification band was very light
Cut out digested vector (see lane 4) and saved in box for tomorrow, will reamplify DNA
Date: July 11, 2012
Digested DNA with restriction enzymes Nde1 and Nco1, cut out band and purify
Ligate together with digested vector from yesterday, transform with Top10 cells and grow overnight
Date: July 12, 2012
Screening showed that the insert was 2x the expected size, start all over
PCR DeepVent Exonuclease domain using 423 pET30b-DeepVent-sso7d as templateand these two primers
DeepVent-Exo-Nde1-F
cgatcacatatggctgaagagctcaagttgctcgcatttg
DeepVent-Exo-R
(gtacgagctcggtagggagttctcc atg gct ggc ggt ggc ggt agccccaag)
cttggggctaccgccaccgccagccatggagaactccctaccgagctcgtac
See lanes 1 and 2, cut out bands, purify for digestion
Digested DNA (lane 2) and pET8XHis 286 (lane 1) with restriction enzymes (Nde1 and Nco1)
Cut out and purified bands, lligate together overnight
Transform with Top10 cells and plate on KAN plates tomorrow morning
Colony Screening
[edit]
All negative, not succesfully transformed. May be because the vector is so light
Date: July 12, 2012
There are positive inserts in lanes 3, 5, 6 and 8, but it is of the incorrect size. Expected is 600 bp but it looks like it is 2x the size
Date: July 16, 2012
Sequencing came back bad, grow more bacteria from bacteria, redid MiniPrep, digested plasmids with RE Nde1 and Nco1. Expected size ~600 bp, redigest tomorrow
Date: July 17, 2012
Digested sample 1 from MiniPrep yesterday (see lane 1), no band. Maybe digest sample 5
Result intepretation/Summary
[edit]
Conclusion
[edit]
Cloning of 1248 pET8XHis-DeepVent-Exo
[edit]Purpose: Cloning of 1248 pET8XHis-DeepVent-Exo
Date: 2012-9-25---2012-9-26
Notebook:0
Page:
Clone ID:1248
Experimenters: yingying
Results
[edit]cloning
[edit]
PCR DeepVent Exonuclease domain using 423 pET30b-DeepVent-sso7d as templateand these two primers
DeepVent-Exo-Nde1-F
DeepVent-Exo-R
| band 5 |
band 6 | |
| pET8XHis 286 |
PCR product | |
| enzymes |
Nde1+Nco1 | |
Colony Screening
[edit]Date: 2012-9-26
no clonies in plate
Result intepretation/Summary
[edit]- <br>
Conclusion
[edit]<br>
<br>
<br>
Cloning of 1248 pET8XHis-DeepVent-Exo
[edit]Purpose: Cloning of 1248 pET8XHis-DeepVent-Exo
Date: 2012-10-15---2012-10-18
Notebook:0
Page:
Clone ID:1248
Experimenters: yingying
Results
[edit]cloning
[edit]
| band 8 |
band 7 | |
| pET8XHis 286 |
PCR product | |
| enzymes |
Nde1+Nco1 | |
Colony Screening
[edit]Date: 2012-10-18
mini prep and digest with Nde1+Nco1
not the right size
Result intepretation/Summary
[edit]- <br>
Conclusion
[edit]<br>
<br>
<br>