3194 pCMV5-IL2-BCMA-(3c)-Fc-WPRE-OriP
Jump to navigation
Jump to search
PCR of 3194
digestion of vector 3192_3194_3200
Miniprep digestion of 3122_984_3192_3194
| # | Lane | Enzymes | Size | Note |
| 3122 | 1-4 | Nde1+Xho1 | ||
| 984 | 5-8 | Xba1+Nhe1 | 957bp | Lane 8 maybe good,need to confirm the size |
| 3192 | 9-12 | Kpn1 | need to confirm the size | |
| 3194 | 13-16 | Nhe1+Kpn1 | 174 | Maybe vector |
not good, all could be parental vector PCR to verify: 3194-R1 GTACCCGCATTCGTTCCTTTCACTG + pCMV5-seq-F
Date:6/5/2018
[edit]redo PCR of 998_1000_3194
3233 subclone_3194 vector digestion
Miniprep of 3196sub_3194pcrclone 3194 miniprep: Nhe1-KpnI digestion
3194 #6 could be good