Editing Synthesis of BGTC (section)

=== Formulation of BGTC:DOPE ===

Mixithe cationic lipid BGTC (5 mg/ml in chloroform) with an appropriate volume of dioleoyl phosphatidyl-ethanolamine (DOPE; Avanti Polar Lipids; 5 mg/ml in chloroform).

Dry under nitrogen.

Disslove the lipid mixture in t-butanol at 37° C., frozen at −80° C., and lyophilize for at least 24 hours.

Store the lipids&nbsp; at −20° C. until use. Stable for 6-8 months or more

Warm up the lipid to room temperature

Resuspend in sterile water (Water for Irrigation (WFI; Baxter, Deerfield, Ill.)) for at least 30 minutes prior to complexing with DNA.

Dilute the DNA in water and add slowly adding to the lipid dispersion while gently vortexing.

Incubate the mixture at room temperature for 15-30 minutes before use.



'''For liposome preparation'''

Weight a cationic lipid DOSP or&nbsp; BGTC&nbsp; or DOTAP (1,2-dioleyl-3-trimethylammoniumpropane) (Avanti Polar Lipids, Alabaster, AL)&nbsp; and tral lipid DOPE (Avanti Polar Lipids) at the ratios 1/1, 3/2, and 1/1 (mol/mol),<font face="Helvetica Neue, Helvetica, Arial, sans-serif"><span style="font-size: 14px; line-height: 20px;">&nbsp;</span></font>&nbsp;respectively to obtain a final concentration of 20 mmol/l of cationic lipid charge

the number of positive charges per molecule: 4 for DOSP, 2 for BGTC, and 1 for DOTAP

Add&nbsp; chloroform to solubilize.

Evaporate chloroform under vacuum to obtain a homogeneous lipid film.

Hydrate with deionized water or 20 mM HEPES, final conc is 1.2 mg/ml

<br/>The next day, votex, sonicate the liposomes in a bath sonicator,&nbsp;<span style="line-height: 20.8px;">&nbsp;store overnight at 4 °C, sonicate again using Branson Sonifier 450 for 5 ~10 min to form liposomes. After centrifugation, filter the slution through a 0.22 u filter. Store at 4 oC.</span>









BGTC shows a high efficiency when used as a no-liposomal formulation

<span style="font-family: Arial, sans-serif; font-size: 14px; line-height: 21px; text-align: justify;">Anti-GFP siRNA (sense sequence: GCAAGCUGACCCUGAAGUUCAU)</span>