Synthesis of BGTC
Synthesis of BGTC
[edit]3/3[N',N'-diguanidinoethyl-aminoethane)carbamoyl] cholesterol, bis-guanidinium tren-cholesterol
TREN: tris(2-aminoethyl)amine
Dissolve a large excess of TREN in Dichloromethane CH2Cl2
React cholesteryl chloroformate in CH2Cl2.
Remove unreacted amine by washing with water
Dissolve crude product in tetrahydrofuran/MeOH (50:50).
Add 2 equivalents of 1H-pyrazole-1 carboxamidine and 2 equivalents of diisopropylethylamine.
diisopropylethylamine: https://us.vwr.com/store/product/4542366/n-n-diisopropylethylamine-min-98-0-gc-tci-america
D1599-100ML $38.66
Stir at room temperature for 18 h
Add diethylether.
separate the resulting precipitate by decantation.
Resuspend this crude compound in diethylether and separated by decantation (60% after drying under vacuum) for three times
Protocol 2
1. Preparation of Aminocarbamate (5)
A solution of cholesteryl chloroformate (1.8 g, 4 mmol) in 100 ml of CH2Cl2 is slowly added to a saturation of tris(2-aminoethyl)amine (TREN) (11.68 g, 80 mmol) in 400 ml of CH2Cl2. After stirring at room temperature for two hours, the inert amine is released by washing with water (3×100 ml) and after drying over Na2SO4, the solvent is evaporated off. (5) is isolated in the trihydrochloride form in the following manner: the crude product is dissolved in 10 ml of MeOH and a saturated methanolic HCl solution (5 ml) is added dropwise; the precipitate obtained is separated by decantation and, to obtain a pure compound, is suspended three times in MeOH and separated by decantation. After drying under vacuum, the pure trihydrochloride (6) is obtained (1.71 g, 64%).
2. Preparation of BGTC
A solution of cholesteryl chloroformate (2.24 g, 5 mmol) in 100 ml of CH2Cl2 is slowly added to a broad saturation of tris(2-aminoethyl)amine (TREN) (29.2 g, 200 mmol) in 250 ml of CH2Cl2. After stirring at room temperature for 2 hours, the inert amine is released by washing with water (3×100 ml) and after drying over Na2SO4, the solvent is evaporated off. The crude product (3.2 g) is dissolved in THF/MeOH 50/50 (20 ml); next, 1H-pyrazole-1-carboximidine (1.465 g, 10 mmol) and diisopropylamine (1.3 g, 10 mmol) are added to the mixture. After stirring at room temperature for 18 hours, diethyl ether is added and the precipitate obtained is separated by decantation. To obtain a pure sample, the crude compound is suspended three times in diethyl ether and separated by decantation (2.15 g), 60% after drying under vacuum.
Synthesis
[edit]based on patent 6,143,729
Add 29.2 ml of tris(2-aminoethyl)amine (TREN, MW 146.236) (29.2 g, 200 mmol) to 250 ml of CH2Cl2 Dichloromethane
Add cholesteryl chloroformate (2.24 g, 5 mmol) in 100 ml of CH2Cl2 Dichloromethane
Stir at room temperature for 2 hours
Wash unreated tris(2-aminoethyl)amine with water (3×100 ml).
Dry over Na2SO4
Evaporate solvent.
Dissolve crude product (3.2 g) in THF/MeOH 50/50 (20 ml)
Add 1H-pyrazole-1-carboximidine (1.465 g, 10 mmol) and diisopropylamine (DIPA, 1.3 g, 10 mmol) (can be subsituted by 1.3 g N,N-Diisopropylethylamine, Hünig’s base’, N-Ethyldiisopropylamine, DIPEA, Ethyldiisopropylamine, or Triethylamine) to the mixture.
Stir at room temperature for 18 hours
Add diethyl ether
Collect the precipitate by decantation.
Repeat 3 times:
- Suspend the crude compound in diethyl ether
- Separate by decantation
dry under vacuum.
Yield: 2.15 g, 60%
BGTC is soluble in choloform, MeOH/Tetrahydrofuran (THF) (1:1), MeOH/Tetrahydrofuran (THF)/ diethyl ether(1:1:1)
Small Scale
[edit]Add 292 ul of tris(2-aminoethyl)amine (TREN, MW 146.236) to 2.5 ml of CH2Cl2 Dichloromethane
Add cholesteryl chloroformate (22.4 mg, 5 ) in 1 ml of CH2Cl2 Dichloromethane
Stir at room temperature for 2 hours
Wash unreated tris(2-aminoethyl)amine with water (3×1 ml).
Dry over Na2SO4
Evaporate solvent.
Dissolve crude product (30mg) in THF/MeOH 50/50 (200 ul)
Add 1H-pyrazole-1-carboximidine (14.65 mg) and diisopropylamine (13mg) to the mixture.
Stir at room temperature for 18 hours
Add diethyl ether
Collect the precipitate by decantation.
Repeat 3 times:
- Suspend the crude compound in diethyl ether
- Separate by decantation
dry under vacuum.
Yield: 21.5 mg, 60%
Formulation of BGTC:DOPE
[edit]Mixithe cationic lipid BGTC (5 mg/ml in chloroform) with an appropriate volume of dioleoyl phosphatidyl-ethanolamine (DOPE; Avanti Polar Lipids; 5 mg/ml in chloroform).
Dry under nitrogen.
Disslove the lipid mixture in t-butanol at 37° C., frozen at −80° C., and lyophilize for at least 24 hours.
Store the lipids at −20° C. until use. Stable for 6-8 months or more
Warm up the lipid to room temperature
Resuspend in sterile water (Water for Irrigation (WFI; Baxter, Deerfield, Ill.)) for at least 30 minutes prior to complexing with DNA.
Dilute the DNA in water and add slowly adding to the lipid dispersion while gently vortexing.
Incubate the mixture at room temperature for 15-30 minutes before use.
For liposome preparation
Weight a cationic lipid DOSP or BGTC or DOTAP (1,2-dioleyl-3-trimethylammoniumpropane) (Avanti Polar Lipids, Alabaster, AL) and tral lipid DOPE (Avanti Polar Lipids) at the ratios 1/1, 3/2, and 1/1 (mol/mol), respectively to obtain a final concentration of 20 mmol/l of cationic lipid charge
the number of positive charges per molecule: 4 for DOSP, 2 for BGTC, and 1 for DOTAP
Add chloroform to solubilize.
Evaporate chloroform under vacuum to obtain a homogeneous lipid film.
Hydrate with deionized water or 20 mM HEPES, final conc is 1.2 mg/ml
The next day, votex, sonicate the liposomes in a bath sonicator, store overnight at 4 °C, sonicate again using Branson Sonifier 450 for 5 ~10 min to form liposomes. After centrifugation, filter the slution through a 0.22 u filter. Store at 4 oC.
BGTC shows a high efficiency when used as a no-liposomal formulation
Anti-GFP siRNA (sense sequence: GCAAGCUGACCCUGAAGUUCAU)
Polyamidoamine Cholesterol
[edit]
+
-->
Add cholesteryl chloroformate to excess ethylenediamine to prepare EDA-Chol (ethylenediamine-cholesterol):
PAM-Chol (polyamidoamine-cholesterol, generation 0.5) is synthesized by Michael addition of the primary amine of ethylenediamine to double bonds of two methyl acrylate molecules, use methyl acrylate/MeOH
Add ethylenediamine to PAM-Chol: the resulting two ester groups of PAM-Chol (generation 0.5) is attacked by ethylenediamine to produce PAM-Chol (generation 1), use ethylenediamine/MeOH
To avoid side reaction and to obtain a perfect dendritic lipid, excess methyl acrylate and ethylenediamine should be added in each step
Methyl acrylate:
Synthesis
[edit]Synthesis of EDA-Chol (A)
Dissolve 80 g (1.3 mol) of ethylenediamine and 4 g (8.9 mmol) of cholesteryl chloroformate in 10 mL of chloroform .
Warm the mixture to 35 oC and stirred for 48 hours.
Wash the reaction mixture with brine (5M NaCl in water) three times.
Spin 5000 RPM for 5 min, Collect organic layer, discard aqueous phase.
Dry over anhydrous sodium sulfate, and evaporate.
Yield is 2.8g of colorless powder.
Synthesis of PAM-Chol g =0.5 (B)
[edit]Dissolve 2.1g (4.5 mmol) of EDA-Chol and 300 mL (3.3 mol) methyl acrylate in 300 mL MeOH.
Warm the mixture to 35 oC and stirred for 48 hours.
Evaporate the organic solvent and excess methyl acrylate.
PAM-Chol g = 0.5 (B) is obtained as 3.0 g of yellow viscous oil.
Synthesis of PAM-Chol g = 1 (C)
[edit]Dissolve 3.0 g PAM-Chol g =0.5 (B) in 300 mL MeOH.
Add 300 mL (4.5 mol) of ethylenediamine to the solution dropwise at 0oC.
Warm the mixture to 35 oC
Stir for 48 hours.
Evaporate the organic solvent and excess ethylenediamine.
Purify PAM-Chol g = 1.0 (C) on silica gel with an eluent of n-propanol: ammonia water: water (70:10:20 to 70:20:10 v/v/v).
The transfection efficiency followed the order of PAM-Chol/DOPE g = 1.0 > DC-Chol/DOPE > PAMAM g = 6.0 (with chloroquine) > PAM-Chol/DOPE g = 2.0 > PAMAM g = 6.0 (without chloroquine). The transfection efficiency of PAM-Chol/DOPE g = 1.0 at the optimal condition was about 3- and 100-fold more efficient than those of DC-Chol/DOPE and PAMAM g = 6.0 (without chloroquine), respectively. PAM-Chol g = 1.0, which requires only one Michael addition/amidation step, showed significantly higher efficiency than PAMAM g = 6.0, which
requires seven iterative Michael addition/amidation steps.
Liposome Preparation: 0.5 mg of DOPE (Sigma, St. Louis, MO) and 0.5 mg of synthetic lipids (PAM-Chol g = 1.0 and g = 2.0) in chloroform were dried under a stream of N2 gas and vacuum. After overnight hydration with 1 mL of distilled water at 4 oC, the mixture was sonicated using a bath-type sonicator
Conclusion: PAM-Chol g = 1 is good enough for transfection, and easy to make
Other Polyamine Cholesterol
[edit]
Synthesis of guanidinylated EDA-Chol and TREN-Chol
[edit]React with tris(2-aminoethyl)amine first
[edit]| Compound # |
Step 1 |
Step 2 | Step 3 | Step 4 | Compound Name |
| 1 | Chol-Chl + tris(2-aminoethyl)amine |
||||
| 2 | Chol-Chl + tris(2-aminoethyl)amine |
|
|
1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA) |
BGTC |
| 3 | Chol-Chl + tris(2-aminoethyl)amine |
methyl acrylate |
tris(2-aminoethyl)amine |
||
| 4 | Chol-Chl + tris(2-aminoethyl)amine | methyl acrylate |
tris(2-aminoethyl)amine |
1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA) |
|
| 5 | Chol-Chl + tris(2-aminoethyl)amine |
methyl acrylate |
ethylenediamine |
||
| 6 | Chol-Chl + tris(2-aminoethyl)amine |
methyl acrylate |
ethylenediamine |
1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA) |
Compound 1,
- Chol-Chl + tris(2-aminoethyl)amine
Compound 2
- Chol-Chl + tris(2-aminoethyl)amine
- 1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA)
Synthesis
Add 29.2 ml of tris(2-aminoethyl)amine (TREN, MW 146.236) (29.2 g, 200 mmol) to 250 ml of CH2Cl2 Dichloromethane
Stir at room temperature for 2 hours
Wash unreated tris(2-aminoethyl)amine with water (3×100 ml).
Dry over Na2SO4
Evaporate solvent.
Dissolve crude product (3.2 g) in THF/MeOH 50/50 (20 ml)
Add 1H-pyrazole-1-carboximidine (1.465 g, 10 mmol) and diisopropylamine (DIPA, 1.3 g, 10 mmol) (can be subsituted by 1.3 g N,N-Diisopropylethylamine, Hünig’s base’, N-Ethyldiisopropylamine, DIPEA, Ethyldiisopropylamine, or Triethylamine) to the mixture.
Stir at room temperature for 18 hours
Add diethyl ether
Collect the precipitate by decantation.
Repeat 3 times
Compound 3
- Chol-Chl + tris(2-aminoethyl)amine
- methyl acrylate
- tris(2-aminoethyl)amine
Compound 4
- Chol-Chl + tris(2-aminoethyl)amine
- methyl acrylate
- tris(2-aminoethyl)amine
- 1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA)
Compound 5
- Chol-Chl + tris(2-aminoethyl)amine
- methyl acrylate
- ethylenediamine
Compound 6
- Chol-Chl + tris(2-aminoethyl)amine
- methyl acrylate
- ethylenediamine
- 1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA)
React with ethylenediamine first
[edit]| Compound # |
Step 1 |
Step 2 | Step 3 | Step 4 | Compound Name |
| 7 | Chol-Chl + ethylenediamine |
||||
| 8 | Chol-Chl + ethylenediamine |
methyl acrylate |
|
|
not for transfection |
| 9 | Chol-Chl + ethylenediamine |
methyl acrylate |
ethylenediamine
|
||
| 10 | Chol-Chl + ethylenediamine | methyl acrylate |
ethylenediamine
|
1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA) |
|
| 11 | Chol-Chl + ethylenediamine |
methyl acrylate |
tris(2-aminoethyl)amine |
||
| 12 | Chol-Chl + ethylenediamine |
methyl acrylate |
tris(2-aminoethyl)amine |
1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA) |
Compound 7
- Chol-Chl + ethylenediamine
Compound 8
- Chol-Chl + ethylenediamine
- methyl acrylate
Compound 9
- Chol-Chl + ethylenediamine
- methyl acrylate
- ethylenediamine
Compound 10
- Chol-Chl + ethylenediamine
- methyl acrylate
- ethylenediamine
- 1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA)
Compound 11
- Chol-Chl + ethylenediamine
- methyl acrylate
- tris(2-aminoethyl)amine
Compound 12
- Chol-Chl + ethylenediamine
- methyl acrylate
- tris(2-aminoethyl)amine
- 1H-pyrazole-1-carboximidine + N-Ethyldiisopropylamine (DIPEA)
Synthesis
[edit]Synthesis of EDA-Chol (A)
[edit]Dissolve 80 g (1.3 mol) of ethylenediamine and 4 g (8.9 mmol) of cholesteryl chloroformate in 10 mL of chloroform .
Warm the mixture to 35 oC and stirred for 48 hours.
Wash the reaction mixture with brine (5M NaCl in water) three times.
Spin 5000 RPM for 5 min, Collect organic layer, discard aqueous phase.
Dry over anhydrous sodium sulfate, and evaporate.
Yield is 2.8g of white powder.
Synthesis of PAM-Chol g =0.5
[edit]Dissolve 2.1g (4.5 mmol) of EDA-Chol and 300 mL (3.3 mol) methyl acrylate in 300 mL MeOH.
Warm the mixture to 35 oC and stirred for 48 hours.
Evaporate the organic solvent and excess methyl acrylate.
PAM-Chol g = 0.5 (B) is obtained as 3.0 g of yellow viscous oil.
Synthesis of PAM-Chol g =1
[edit]Dissolve 3.0 g PAM-Chol g = 0.5 in 300 mL MeOH.
Add PAM-Chol g = 0.5 solution dropwise to 300 mL (4.5 mol) of ethylenediamine at 0 oC.
Warm the mixture to 35 oC and stirred for 48 hours.
Evaporate the organic solvent and excess ethylenediamine.
The product, PAM-Chol g = 1.0 (C), is purified on silica gel with an eluent of n-propanol: ammonia water: water (70:10:20 to 70:20:10 v/v/v).
Lipisome Analysis
[edit]0.5 mg of DOPE (Sigma, St. Louis, MO) and 0.5 mg of synthetic synthetic lipids (PAM-Chol g = 1.0 and g = 2.0) in chloroform is dried under a stream of N2 gas and vacuum. After overnight hydration with 1 mL of distilled water at 4 oC, the mixture is sonicated using a bath-type sonicator. Lipoplexes between cationic lipid and plasmid DNA is prepared at different charge ratios by incubation in serum-free DMEM at room temperature for 30 minutes. Each sample is then analyzed by electrophoresis on a 0.7%(w/v) agarose gel containing ethidium bromide (0.5 μg/mL).
