Editing FTA Card PCR (section)

== For DNA storage ==

Autoclave Whatman No.1 paper &nbsp; with a dry cycle. &nbsp;then treat &nbsp;with a solution of 40 mM uric acid and 100 mm tris (free base).

1. DNA Templates

Apply 3 μl of human blood a 3 mm square sample of FTA card Let blood dry This 3 mm square can be used in each PCR reaction 3 μl of blood corresponds to approximately 250 nanograms of white-cell DNA.&nbsp;

2. Primers

Two synthetic oligonucleotide primers derived from the human Class II HLA gene, DQ-alpha, were used in the experiments. Their sequences are:

5' GTGCTGCAGGTGTAAACTTGTACCAG 3'&nbsp;

5' CACGGATCCGGTAGCAGCGGTAGAGTTC 3'&nbsp;

The size of the PCR product expected using the two primers is 262 bp.&nbsp; Each primer can be stored as a stock solution at a concentration of 50 ng/ul.&nbsp; When adding to the dry solid medium prior to processing, 150 ng of both primers is added to the 3 mm square of dry solid medium.&nbsp; The primers should be always used together at equal concentrations.

Elute DNA from FTA Card uby&nbsp;Single Phase Phenol Wash

Solution A: Single-phase phenol solution.&nbsp; 50 g of phenol, &nbsp;120 mg of 8-hydroxyquinoline Add 10 ml of 1.0 M Tris-acetate pH 8.0&nbsp; 1.0 ml of 2-β-mercaptoethanol.&nbsp;

(10 ml of 1.0M tris-acetate pH 8.0 and 1.0 ml 2-mercaptoethanol)

After saturation at between 0° C. and 4° C, remove and discard the aqueous phase&nbsp;

Solution B: Aqueous alcohol wash solution.&nbsp; 75% v/v isopropanol, 25% v/v 0.1M potassium acetate, pH 7.8.

Solution C: Ionic aqueous wash solution.&nbsp; 75% v/v isopropanol, 25% v/v 0.01M magnesium acetate.

(a) Removal of Protein: a 0.5 cm×0.5 cm square of blood DNA impregnated paper is treated with 1 ml of solution A, for example for approximately 1.5 hours at 45° C. (this temperature and time is not critical). The dirty solution A is then aspirated to waste and the paper square quickly washed three times with 0.25 ml of more solution A. Each wash need be only a few seconds long and is immediately aspirated to waste.

(b) Removal of phenol and addition of suitable ions: the paper in its tube from step (a) above, is rapidly washed in three lots of 1 ml of solution B. Washes are at room temperature and are simple additions followed by aspiration to waste. The paper is then washed for 20 minutes at room temperature with solution C. (This is to saturate the DNA on the paper with Magnesium ions and remove the last of the phenol.) The solution C is aspirated to waste and the paper is solvent-dried with one wash of pure isopropanol and then vacuum dried.

The final DNA-paper should be quite white without any obvious remnants of the red-brown colour of blood. It is now ready for use in a PCR reaction mix.



B. Method

1. Washing the Dry Solid Medium

Wash dry FTA card with 200 μl of Solution A for two hours at either 37° C. or 50° C.,&nbsp; Two quick rinses of the aqueous phase with Solution A.&nbsp; Rinse FTA card for five minutes each with 200 μl of Solution B at room temperature.&nbsp; Wash FTA card with 200 μl of Solution C for 20 minutes at room temperature&nbsp; Dry FTA card under vacuum.&nbsp; In practice, shorter times may be used. The effectiveness of the washes may be monitored by observing loss of color: (1) the hemoglobin; and (2) the hydroxyquinoline.)