FTA Card PCR

FTA Solution

160 mM Tris 
7.8 mM EDTA 
2% w/v SDS 
0.672% w/v uric acid

FTA Card Treatment

cellulose-based paper such as filter paper  having a minimal loading, per sq.cm. of paper, as follows:

(a) EDTA: 0.5 micromols (146.1 mg of free acid)

(b) Tris: 8 micromols (968.8 mg of free base)

(c) SDS: 1 mg; and optionally

(d) uric acid: 2 micromols (336.24 mg of acid).

use of uric acid or a urate salt in accordance with this invention has been found to be particularly important for the long term storage of DNA as this component performs a number of functions Firstly, it is converted into allantoin in acting as a "free-radical" trap that preferentially accepts free radicals, that would otherwise damage the base guanine in the DNA, (e.g. 2,3). Such free radicals are generated by the spontaneous oxidation of thio groups in the denatured serum protein, and may also be generated by the large amount of iron in blood4. The uric acid also acts as a component of the buffering system in that it is a weak acid. It also acts as an erodible surface in that it is sparingly soluble so that DNA-containing material dried onto its crystals will be released as the urate beneath them erodes.

How to make FTA card

Apply Sodium dodecyl sulphate to Whatman 3 mm paper in a solution such that there is approximately 50 μl per sq.cm. of a solution of 2% sodium dodecyl sulphate, 10 mM EDTA, and 60 mM tris (free base), i.e. approximately 1 mg of sodium dodecyl sulphate per sq.cm.  The paper is then dried.

DNA elution from FTA Card

methanol fixation method. The sample spot was fixed by overlaying with methanol (4 drops delivered via Pasteur pipette; AJAX, Taren Pt, NSW, Australia) three times and allowed to air-dry in between (the first time at room temperature for 20 min and the next two times incubated at 37°C for 40 min each). Genomic DNA was then eluted from the paper in a heat incubation step run on a PCR machine. Using flat nosed forceps, dry sample spots were transferred to a thin-walled 0.2-mL PCR tube containing 5 μL 10× PCR buffer (Invitrogen, Mt Waverley, VIC, Australia) and 45 μL water and Proteinase K (50 μg/mL; Roche, Castle Hill, NSW, Australia). The tube was subjected to one cycle of 60°C for 30 min, 99.9°C  for 10 min, then cooled to 4°C. The FTA paper was left in the tube with the eluant and stored at 4°C. PCR reactions were performed using 2 μL extracted product

For DNA storage

Autoclave Whatman No.1 paper   with a dry cycle.  then treat  with a solution of 40 mM uric acid and 100 mm tris (free base).

1. DNA Templates

Apply 3 μl of human blood a 3 mm square sample of FTA card Let blood dry This 3 mm square can be used in each PCR reaction 3 μl of blood corresponds to approximately 250 nanograms of white-cell DNA. 

2. Primers

Two synthetic oligonucleotide primers derived from the human Class II HLA gene, DQ-alpha, were used in the experiments. Their sequences are:

5' GTGCTGCAGGTGTAAACTTGTACCAG 3' 

5' CACGGATCCGGTAGCAGCGGTAGAGTTC 3' 

The size of the PCR product expected using the two primers is 262 bp.  Each primer can be stored as a stock solution at a concentration of 50 ng/ul.  When adding to the dry solid medium prior to processing, 150 ng of both primers is added to the 3 mm square of dry solid medium.  The primers should be always used together at equal concentrations.

Elute DNA from FTA Card uby Single Phase Phenol Wash

Solution A: Single-phase phenol solution.  50 g of phenol,  120 mg of 8-hydroxyquinoline Add 10 ml of 1.0 M Tris-acetate pH 8.0  1.0 ml of 2-β-mercaptoethanol. 

(10 ml of 1.0M tris-acetate pH 8.0 and 1.0 ml 2-mercaptoethanol)

After saturation at between 0° C. and 4° C, remove and discard the aqueous phase 

Solution B: Aqueous alcohol wash solution.  75% v/v isopropanol, 25% v/v 0.1M potassium acetate, pH 7.8.

Solution C: Ionic aqueous wash solution.  75% v/v isopropanol, 25% v/v 0.01M magnesium acetate.

(a) Removal of Protein: a 0.5 cm×0.5 cm square of blood DNA impregnated paper is treated with 1 ml of solution A, for example for approximately 1.5 hours at 45° C. (this temperature and time is not critical). The dirty solution A is then aspirated to waste and the paper square quickly washed three times with 0.25 ml of more solution A. Each wash need be only a few seconds long and is immediately aspirated to waste.

(b) Removal of phenol and addition of suitable ions: the paper in its tube from step (a) above, is rapidly washed in three lots of 1 ml of solution B. Washes are at room temperature and are simple additions followed by aspiration to waste. The paper is then washed for 20 minutes at room temperature with solution C. (This is to saturate the DNA on the paper with Magnesium ions and remove the last of the phenol.) The solution C is aspirated to waste and the paper is solvent-dried with one wash of pure isopropanol and then vacuum dried.

The final DNA-paper should be quite white without any obvious remnants of the red-brown colour of blood. It is now ready for use in a PCR reaction mix.

B. Method

1. Washing the Dry Solid Medium

Wash dry FTA card with 200 μl of Solution A for two hours at either 37° C. or 50° C.,  Two quick rinses of the aqueous phase with Solution A.  Rinse FTA card for five minutes each with 200 μl of Solution B at room temperature.  Wash FTA card with 200 μl of Solution C for 20 minutes at room temperature  Dry FTA card under vacuum.  In practice, shorter times may be used. The effectiveness of the washes may be monitored by observing loss of color: (1) the hemoglobin; and (2) the hydroxyquinoline.)

DNA extraction from DBSs

For single-stranded DNA (ssDNA) extraction, DBSs on the cards were cut into small pieces with scissors and transferred into 1.5-mL microtubes to which 500 μL dH2O had been added; the tubes were kept at room temperature for 5 minutes. The dH2O was discarded, and the procedure was repeated twice. The filter papers were soaked in 500 μL extraction buffer [phosphate-buffered saline (PBS) or 10 mM Tris-EDTA (TE)].

For lysis, red blood cell lysis buffer (100 μL) was added to the filter papers, which were then incubated with 10 μL (1 mg/mL) proteinase K at 37°C overnight. After blood cell lysis, the filter papers were pressed against the bottom of the tube several times with a clean pipette tip [20]. For increased extraction efficiency, cell lysates were incubated at 95°C for 15 minutes. Filter papers were removed after brief centrifugation (2–3 seconds), and the DNA-containing supernatant was stored at −80°C until analysis.

For double-stranded DNA (dsDNA) extraction, each filter paper sample that had been punched out was soaked in 40 μL Tris-EDTA buffer or PBS, and incubated at 37°C overnight.