Editing 1140 pTXB1-polyAPol

== '''Cloning of 1140 pTXB1-polyAPol'''  ==

'''Purpose:''' Cloning of 1140 pTXB1-polyAPol

'''Date: '''July 23, 2012<br> 

'''Notebook:&nbsp;''' 

'''Page:''' 

'''Clone ID: '''1140 

'''Experimenters: '''Jennifer Truong 

== '''Results'''  ==

=== Cloning  ===

Date:&nbsp;July 23, 2012<br>

[[Image:1140_Amp.JPG]]<br>

Expected size 1398 bp, see lanes 5 and 6<br>

PCR from MG1665 genomic DNA

polyAPol-Nde1-F<br>cgagca CATATGatttttacccgagtcgctaatttttg

polyAPol-Xho1-R<br>(caccacgtcgtgagggtaccgca CTCGAG atacta)<br>tagtatCTCGAGtgcggtaccctcacgacgtggtg

Clone into Nde1 + Xho1 1254 pTXB1-PT-ELK<br>

[[Image:0726_Digestion.JPG]]

See lane 9 (insert and vector digested together - top is vector bottom is insert)

Cut out both bands and ligate together to transform 

=== <u></u>Colony Screening<br>  ===

Date:&nbsp;July 27, 2012

[[Image:0727_Digestion_2.JPG]]

Digested MiniPrep with RE Nde1 and Xho1

Expected size 1398 bp, see lanes 1-6

Samples 3, 5 and 6 may be right, submit sample 5 to sequencing

== '''Result intepretation/Summary'''  ==

<br> 

== '''Conclusion'''  ==

<br> 

[[Category:Cloning]]