Editing Cloning and Sequencing of Antibody Viable Region from Hybridoma

== Primers ==

adaptor-BamH1-F actagCTCGAGcatatgggatccc &nbsp;

== Total RNA ==

Extract of total RNA In general, 0.5 µg to 1.0 µg total RNA is sufficient for the amplification of specific Ig variable regions by 5’-RACE.&nbsp;



== SMART Protocol ==

When reverse transcriptase reaches the 5¢ end of the mRNA, the enzyme’s terminal transferase activity adds additional nucleotides (predominantly dCTP) that are not encoded by the template.

=== '''Takara protocol''' ===

Mix:<br/>1 µl Total RNA (500 ng/µl)<br/>1 µl RT primer (12 pmol/µl)<br/>1.75 µl ddH2O<br/>3.75 µl Total

Incubated at 72°C for 3<br/>min, followed by 42°C for 2 min in order to denature<br/>the RNA.&nbsp;<br/>Add 1 µl of the SMARTer II A Oligonucleotide<br/>(12 µM) --> for a total volume<br/>of 4.75 µl

SMART template-switching oligonucleotide

5 ′ -d(AAGCAGTGGTATCAACGCAGAGTGGCCATTA’TGGCC)-r(GGG)-3 ′&nbsp;

cDNA synthesis (CDS) primer:

5 ′ -d(ATTCTAGAGGCCGAGG’CGGCCGACATGT(30)VN)-3′

(N = A, G, C or T; V = A, G or C)

5′anchor primer:

5 ′ -d(AAGCAGTGGTATCAACGCAGAGT)-3

4) double-stranded adaptor (for conventional library construction)

5 ′ -d(AATTCGCGGCCGCGTCGTCGAC)

&nbsp; &nbsp;d(GCGCCGGCGCAGCAGCTG)-PO4 -5'

a 5µL cDNA synthesis mixture containing 1 µL skeletal muscle poly(A) +RNA (1 µg), 1 µL cDNA synthesis (CDS) primer (10 µM), 1 µL template-switching (TS)-oligonucleotide (10 µM) and 2 µL deionized water were incubated at 72°C for 2 min and then immediately placed in an ice-water bath for 2 min. The volume was then adjusted to 10 µL with the following reagents: 2 µ L 5×first-strand synthesis buffer (250 mM Tris-HCl, pH 8.3, 30 mM MgCl 2, and 375 mM KCl), 1 µL dithiothreitol (DTT) (20 mM), 1 µL dNTP mixture (10 mM each dATP, dCTP, dGTP, and dTTP), and 1 µL (200 U) MMLV reverse transcriptase (RNase H-point mutant). Re verse transcription and template switching was carried out at 42°C for 60 min in an air incubator. The reaction was termi nated by placing the tube on ice.



Double-Stranded cDNA Synthesis by Low-Cycle PCR<br/>After first-strand synthesis, RNA was degraded by adding 1 µL 25 mM NaOH to the first-strand synthesis mixture and incubating at 68°C for 30 min. Double-stranded cDNA was synthesized by low-cycle PCR in a 100µL reaction contain ing: 40 mM Tricine-KOH, pH 9.2; 15 mM KOAc; 3.5 mM Mg(OAc) 2; 0.2 µM 5′-anchor primer; 0.2 µM CDS primer; 0.2 mM each dATP, dGTP, dCTP, and dTTP; and 2 µL Advantage cDNA Polymerase Mix (50×; contains KlenTaq-1 and Deep Vent polymerases; CLONTECH Laboratories). Low-cycle PCR was carried out on a DNA Thermal Cycler 480 (Applied Biosystems, Foster City, CA, USA) using the&nbsp;following cycling conditions: 72°C for 10 min, 95°C for 1 min, and 3 cycles at 95°C for 15 s and 68°C for 8 min. Dou ble-stranded cDNA synthesis was analyzed by visualization on 1.1% agarose/ethidium bromide gels



Prepare Master RT mix

2 µl 5X First-Strand Buffer

1 µl DTT (20 mM)

1 µl dNTP Mix (10 mM)

0.25 µl RNase Inhibitor (40 U/µl

1 µl SMARTScribe Reverse Transcriptase (100 U/µl)

5.25 µl Total

Add this &nbsp;Master Mix &nbsp;to each reaction for a total of 10 µl.

Incubate at 42°C for 90 min, followed by 72°C for 10 min.

Add 50 µl Tricine-EDTA Buffer 1

Store&nbsp;at –20°C&nbsp;

'''RACE'''

10 µl 5X PrimeSTAR Buffer (Mg2+ )

4 µl dNTP Mixture (2.5 mM)

2.5 µl First-strand cDNA

5 µl 10X UPM (Universal Primer A Mix)

1 µl 5'-RACE primer (10 pmol/μl)

0.5 µl PrimeSTAR HS DNA Polymerase (2.5 U/µl)

27 µl H2O

50 µl Total



94°C 10 sec

30 cycles: 98°C 10 sec, 60°C 5 sec, 72°C 1 min

72°C 3 min







'''5-µL cDNA synthesis mixture:'''

1 µL &nbsp; poly(A)+ RNA (1 µg),

1 µL 10 µM gene specific primer, &nbsp;for mouse IgG2b

<s>mIgG2b-HC-RT-R &nbsp; &nbsp; &nbsp; GTGTGCACACCTTCCCAGCT&nbsp;</s>

mIgG2b-HC-RT-R2&nbsp;&nbsp; &nbsp;AGTCACAGTCACTGACTCAGG

2495-mIgG2a-kLC-RT-R 

GAAGCACACGACTGAGGCACC 

(GGTGCCTCAGTCGTGTGCTTC)

1 µL 10 µM template-switching (TS)-oligonucleotide,&nbsp; Adaptor-3G-F ACTAGCTCGAGCATATGGGATCCrGrGrG

2 µL deionized water

Incubated at 72°C for 2 min

Immediately placed in an ice-water bath for 2 min.



Add 2 µL 5× first-strand synthesis buffer (250 mM Tris-HCl, pH 8.3, 30 mM MgCl2 , and 375 mM KCl), 1 µL dithiothreitol (DTT) (20 mM)

1 µL dNTP mixture (10 mM each dATP, dCTP, dGTP, and dTTP),

1 µL (200 U) MMLV reverse transcriptase (RNase H- point mutant).

Incubate at 42°C for 60 min

Put on ice.

'''Degrade RNA:'''

Add 1 µL 25 mM NaOH to the first-strand synthesis mixture

Incubating at 68°C for 30 min





=== PCR: ===

'''Mouse IgG2b Heavy Chain'''

mIgG2b-HC-PCR-R &nbsp;TTGACCAGGCATCCCAGAGTC&nbsp;

<s>adaptor-BamH1-F actagCTCGAGcatatgggatccc</s>

<br/>Adaptor-BamH1-F2&nbsp;&nbsp; &nbsp;ACTAGCTCGAGCATATGGGATCC



'''Light Chain kapp'''

2495-kLC-Const-R&nbsp;<br/>TGTTAACTGCTCACTGGATGGTGG<br/>(CCACCATCCAGTGAGCAGTTAACA)



<s>adaptor-BamH1-F actagCTCGAGcatatgggatccc</s>

Adaptor-BamH1-F2&nbsp;&nbsp; &nbsp;ACTAGCTCGAGCATATGGGATCC













in 50-µL reaction containing: 40 mM Tricine-KOH, pH 9.2; 15 mM KOAc; 3.5 mM Mg(OAc)2&nbsp;

1 ul of 10 &nbsp;µM 5′-anchor primer:<s>adaptor-BamH1-F actagCTCGAGcatatgggatccc&nbsp;</s>

Adaptor-BamH1-F2&nbsp;&nbsp; &nbsp;ACTAGCTCGAGCATATGGGATCC

1 ul of 10&nbsp;µM gene specific primer;&nbsp;mIgG2b-HC-PCR-R &nbsp;TTGACCAGGCATCCCAGAGTC&nbsp;

1ul of 10&nbsp;mM dNTP&nbsp;

1 µL Advantage&nbsp;cDNA Polymerase Mix (50×; contains KlenTaq-1 and Deep Vent polymerases)



Smart kit:

(A): SMART Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ CDS primer 5'- AAGCAGTGGTATCAACGCAGAGTTTTTGTTTTTTTCTTTTTTTTTTVN -3' .

or (B) the GsuI option: SMART Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ SmartGsu T20 5’-AAGCAGTGGTATCAACGCAGAGTA(CTGGAG)d(T)20VN-3’

Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ CDS primer 5'- AAGCAGTGGTATCAACGCAGAGTTTTTGTTTTTTTCTTTTTTTTTTVN -3'



SMART IV Oligonucleotide (12 μM) 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' CDS III/3' PCR Primer (12 μM) 5'-ATTCTAGAGGCCGAGGCGGCCGA

== [https://www.ncbi.nlm.nih.gov/igblast/ https://www.ncbi.nlm.nih.gov/igblast/] ==

== TdT Protocol ==

=== 1st Strand ===

1st strand synthesis using and MMLV reverse transcriptase

==== Heavy Chain: ====

 2490-mIgG2aHC-RT-R 
 gttttgtgggtgctgagctc
 (gagctcagcacccacaaaac)

or better with &nbsp;

 2494_mIgG2a-HC-RT-R2
 GGTGTGCACACCTTCCCAG
 (CTGGGAAGGTGTGCACACC)

==== Light Chain ====

 2495-mIgG2a-kLC-RT-R	
 GAAGCACACGACTGAGGCACC
 (GGTGCCTCAGTCGTGTGCTTC)





2 ul (2 µg) purified total RNA;<br/>1 µl&nbsp;of appropriate constant region primer (e.g., 0.5 ul of 2490-mIgG2aHC-RT-R + 0.5 ul &nbsp;of 2495-mIgG2a-kLC-RT-R&nbsp; )

1 ul 10 mM dNTP

Water to 15 ul

65 oC for 5 min.

Chill on ice.

Add&nbsp;<br/>4 µl 5× RT&nbsp;buffer

1 ul Maxima H min Enzyme Mix

Incubate at RT for 10 min, then 15 min at 50 oC



== Another TdT Protocol ==

=== RT Reaction ===

1 ul MMLV: &nbsp;40 U SuperScript™ III (Invitrogen) &nbsp;containing 2 U RNaseOUT™ (Invitrogen)

1 ul of &nbsp;2.5&nbsp;mM dNTP (0.5 mM final)

&nbsp;0.25 pmol each gene specific RT primers (mix). i.e.

1 ul of 0.25 uM oligo mix:

0.25 uM oligo mix: e.g., 1 ul of 1 uM primer A + 1 ul of &nbsp;1 uM primer B &nbsp;+ 2 ul of H2O)&nbsp;

1 ul of 5X RT Buffer

1X RT Buffer: 1.5 mM MgCl2, 37.5 mM KCl, 10 mM DTT, 0.25% Nonidet™ P-40 (NP40), and 0.1 mg/mL bovine serum albumin (BSA) in 25 mM TrisHCl, pH 8.3

in 5ul&nbsp;reaction

Incubate 1 h at 55°C



=== 3' Tailing ===

To &nbsp;the above reverse transcription reaction &nbsp;add

1 μL of 10× tailing reaction reagents containing 100 mM MgCl2, 10 mM DTT, 100 mM Tris-HCl, pH 7.5

1 ul of 100&nbsp;mM dGTP (2 mM)

1 ul TdT-->7.5 U terminal deoxynucleotidyl-transferase

2 ul water to final vol of 10 μL

Incubate 1 h at 37°C

'''NEB 1X'''<span style="color: rgb(76, 76, 76); font-family: Arial, Helvetica, sans-serif;">&nbsp;</span>'''Terminal Transferase Reaction Buffer (may not be compatible)'''<br/><span style="color: rgb(76, 76, 76); font-family: Arial, Helvetica, sans-serif;">50 mM Potassium Acetate</span><br/><span style="color: rgb(76, 76, 76); font-family: Arial, Helvetica, sans-serif;">20 mM Tris-acetate</span><br/><span style="color: rgb(76, 76, 76); font-family: Arial, Helvetica, sans-serif;">10 mM Magnesium Acetate</span><br/><span style="color: rgb(76, 76, 76); font-family: Arial, Helvetica, sans-serif;">pH 7.9 @ 25°C</span>



===  ===

=== Second-strand synthesis ===

dGTP-tailed cDNA is used without purification as a template for second strand cDNA synthesis.&nbsp;<br/>1.25 U Phusion<br/>1 ul of 10 uM oligo(dC) adaptor&nbsp;<br/>1 ul 10 mM dNTP&nbsp;<br/>10 ul 5X Phusion Buffer

1 X94°C for 3 min

23 cycles:&nbsp;<br/>30 s at 94°C<br/>30 s at 60°C<br/>3 min at 72°C





=== PCR ===

5 ul of the 2nd Strand reaction

1 ul 10 uM nest primer F

1 ul 10 uM nest primer&nbsp;R

1 ul 10 mM dNTP

5 ul 5 X Phusion Buffer

1 ul Phusion

11 ul H2O





<br/><del>25 U RNasin Ribonuclease Inhibitor;<br/>200 U M-MLV reverse transcriptase;</del>

Before adding the rest of the reaction mixture, prepare the RNA and corresponding<br/>constant region primer in a separate tube, and heat to 70 °C for 10 min, to disrupt any RNA<br/>secondary structure that might have formed. After heating, place the tube immediately on ice<br/>to prevent secondary structure reforming. RNA can form very stable secondary structures that<br/>can markedly reduce the efficacy of reverse transcription. Add the rest of the reverse<br/>transcriptase mix to the tube, mix gently, spin down, and incubate at 50 °C for 60 min.&nbsp;

Purify using spin column (add 500 ul QG buffer), elute with 25 ul H2O

=== <br/>TdT tailing ===

<br/>Terminal Deoxyribonucleotide Transferase (Promega, Madison, WI, USA);<br/>dNTP (e.g. dATP) (Fermentas, Vilnius, Lithuania).&nbsp;<br/>A homopolymeric tail is added to the 3’-end of the first-strand cDNA in a reaction that is<br/>catalysed by terminal deoxynucleotidyl transferase (TdT) using only one of the possible four<br/>dNTPs. Usually, 20-100 nucleotides are added to the DNA fragment in the tailing reaction,<br/>and these represent a primer binding site for second-strand synthesis.<br/>For addition of the poly(A) tail, prepare the following reaction mixture in a sterile<br/>microcentrifuge tube on ice, in a total reaction volume of 20 µl:<br/>5-10 µl purified first-strand cDNA (the optimal amount depends on the amount of RNA<br/>used in the first-strand reaction and on the purification efficiency);



To the column purified (eluted from spin column) 1st cDNA:

Add<br/>2.5 µl 5× TdTbuffer;

2.5 ul 2.5 mM CoCl2

1 ul 10 mM dGTP&nbsp;<br/>1 ul &nbsp;TdT;<br/><br/>Incubate for 1 h at 37 °C, and then for 10 min at 70 °C, to inactivate the enzyme. Place the tube on ice.

Isolate the poly(A)-tailed cDNA with a DNA Purification kit.

TdT buffer is&nbsp;not compatible with the PCR buffer system, therefore the tailed cDNA has to be purified before PCR.&nbsp;

=== <br/>PCR amplification of the Ig variable-region sequence&nbsp; ===

<del>2494_IgG2a-HL-Const-BamH1-F</del>

<del>actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT</del>

==== Heavy Chain ====

Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC

adaptor-BamH1-F actagCTCGAGcatatgggatccc

 2494_IgG2a-HL-Const-R&nbsp;
 constant
 GGTCAAGGTGACTGGCTCAGGGAA
 (ttccctgagccagtcaccttgacc )



==== Light Chain kappa ====

 2495-kLC-Const-R 
 TGTTAACTGCTCACTGGATGGTGG
 CCACCATCCAGTGAGCAGTTAACA)

Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC

adaptor-BamH1-F actagCTCGAGcatatgggatccc







PCR using Phusion Enzyme



Finally, the Ig-coding variable region is amplified in a PCR reaction using two primers:<br/>one complementary to the 5’-end (constant region) and the other complementary to the<br/>homopolymeric tail at the 3’-end of first-strand cDNA. Phusion HF polymerase<br/>is preferred for RACE, due to its lower error rate.

Prepare the following PCR reaction mixture, in a total reaction volume of 50 µl:<br/>10 µl 5× reaction buffer;<br/>&nbsp;<br/>1 ul of 10 &nbsp;µM constant region primer&nbsp;

(e.g. constant region primer &nbsp;2494_IgG2a-HL-Const-R &nbsp;GGTCAAGGTGACTGGCTCAGGGAA )

1 ul &nbsp;of 1 uM Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC&nbsp;

1 ul of 10 uM adaptor-BamH1-F actagCTCGAGcatatgggatccc

1ul of 10 µM dNTP mix;<br/>1 ul Phusion &nbsp;polymerase;<br/>X ul Nuclease-free water. to 50 ul.<br/>Incubate in a thermal cycler preheated to 95 °C, using the following conditions:<br/>Initial denaturation at 95 °C for 5 min, followed by 33 cycles of:<br/>95 °C for 1 min;<br/>55 °C for 1 min;<br/>68 °C for 1 min.<br/>Incubate at 68 °C for 10 min, then cool to 4 °C and store at -20 °C.&nbsp;

== Inverted PCR Protocol ==

After oligo dT priming, ligate with 1 ul T4 ligase, then PCR:

&nbsp;5'-GTCCACGAGGTGCTGCACAAT (IgG2-CH3, first primer), 5'-GTCACTGGCTCAGGGAAATAACC (IgG2-CHi, second primer); b) for IgGl heavy chain amplification: 5'-CCTGCTCTGTGTTACATGAGGG (IgGI-CH3, first primer), 5'-CCCAGGGTCACCATGGAGTTAG (IgGl-CH1, second primer); for kappa light chain amplification: 5'-AAGATGGATACAGTTGGTGC (K-CLA,first primer), 5'-TGTCAAGAGCTTCAACAGGA (K-CLB, second primer). &nbsp;PCR product size=700~800 bp



==  ==

== Clone into pMiniT vector ==

==  ==

== Sequencing ==
[[Category:Protocols]] [[Category:Antibody]] [[Category:Antibodies]]