Cloning and Sequencing of Antibody Viable Region from Hybridoma

Primers

adaptor-BamH1-F actagCTCGAGcatatgggatccc  

Total RNA

Extract of total RNA In general, 0.5 µg to 1.0 µg total RNA is sufficient for the amplification of specific Ig variable regions by 5’-RACE. 

SMART Protocol

When reverse transcriptase reaches the 5¢ end of the mRNA, the enzyme’s terminal transferase activity adds additional nucleotides (predominantly dCTP) that are not encoded by the template.

Takara protocol

Mix:
1 µl Total RNA (500 ng/µl)
1 µl RT primer (12 pmol/µl)
1.75 µl ddH2O
3.75 µl Total

Incubated at 72°C for 3
min, followed by 42°C for 2 min in order to denature
the RNA. 
Add 1 µl of the SMARTer II A Oligonucleotide
(12 µM) --> for a total volume
of 4.75 µl

SMART template-switching oligonucleotide

5 ′ -d(AAGCAGTGGTATCAACGCAGAGTGGCCATTA’TGGCC)-r(GGG)-3 ′ 

cDNA synthesis (CDS) primer:

5 ′ -d(ATTCTAGAGGCCGAGG’CGGCCGACATGT(30)VN)-3′

(N = A, G, C or T; V = A, G or C)

5′anchor primer:

5 ′ -d(AAGCAGTGGTATCAACGCAGAGT)-3

4) double-stranded adaptor (for conventional library construction)

5 ′ -d(AATTCGCGGCCGCGTCGTCGAC)

   d(GCGCCGGCGCAGCAGCTG)-PO4 -5'

a 5µL cDNA synthesis mixture containing 1 µL skeletal muscle poly(A) +RNA (1 µg), 1 µL cDNA synthesis (CDS) primer (10 µM), 1 µL template-switching (TS)-oligonucleotide (10 µM) and 2 µL deionized water were incubated at 72°C for 2 min and then immediately placed in an ice-water bath for 2 min. The volume was then adjusted to 10 µL with the following reagents: 2 µ L 5×first-strand synthesis buffer (250 mM Tris-HCl, pH 8.3, 30 mM MgCl 2, and 375 mM KCl), 1 µL dithiothreitol (DTT) (20 mM), 1 µL dNTP mixture (10 mM each dATP, dCTP, dGTP, and dTTP), and 1 µL (200 U) MMLV reverse transcriptase (RNase H-point mutant). Re verse transcription and template switching was carried out at 42°C for 60 min in an air incubator. The reaction was termi nated by placing the tube on ice.

Double-Stranded cDNA Synthesis by Low-Cycle PCR
After first-strand synthesis, RNA was degraded by adding 1 µL 25 mM NaOH to the first-strand synthesis mixture and incubating at 68°C for 30 min. Double-stranded cDNA was synthesized by low-cycle PCR in a 100µL reaction contain ing: 40 mM Tricine-KOH, pH 9.2; 15 mM KOAc; 3.5 mM Mg(OAc) 2; 0.2 µM 5′-anchor primer; 0.2 µM CDS primer; 0.2 mM each dATP, dGTP, dCTP, and dTTP; and 2 µL Advantage cDNA Polymerase Mix (50×; contains KlenTaq-1 and Deep Vent polymerases; CLONTECH Laboratories). Low-cycle PCR was carried out on a DNA Thermal Cycler 480 (Applied Biosystems, Foster City, CA, USA) using the following cycling conditions: 72°C for 10 min, 95°C for 1 min, and 3 cycles at 95°C for 15 s and 68°C for 8 min. Dou ble-stranded cDNA synthesis was analyzed by visualization on 1.1% agarose/ethidium bromide gels

Prepare Master RT mix

2 µl 5X First-Strand Buffer

1 µl DTT (20 mM)

1 µl dNTP Mix (10 mM)

0.25 µl RNase Inhibitor (40 U/µl

1 µl SMARTScribe Reverse Transcriptase (100 U/µl)

5.25 µl Total

Add this  Master Mix  to each reaction for a total of 10 µl.

Incubate at 42°C for 90 min, followed by 72°C for 10 min.

Add 50 µl Tricine-EDTA Buffer 1

Store at –20°C 

RACE

10 µl 5X PrimeSTAR Buffer (Mg2+ )

4 µl dNTP Mixture (2.5 mM)

2.5 µl First-strand cDNA

5 µl 10X UPM (Universal Primer A Mix)

1 µl 5'-RACE primer (10 pmol/μl)

0.5 µl PrimeSTAR HS DNA Polymerase (2.5 U/µl)

27 µl H2O

50 µl Total

94°C 10 sec

30 cycles: 98°C 10 sec, 60°C 5 sec, 72°C 1 min

72°C 3 min

5-µL cDNA synthesis mixture:

1 µL   poly(A)+ RNA (1 µg),

1 µL 10 µM gene specific primer,  for mouse IgG2b

mIgG2b-HC-RT-R       GTGTGCACACCTTCCCAGCT 

mIgG2b-HC-RT-R2    AGTCACAGTCACTGACTCAGG

2495-mIgG2a-kLC-RT-R

GAAGCACACGACTGAGGCACC

(GGTGCCTCAGTCGTGTGCTTC)

1 µL 10 µM template-switching (TS)-oligonucleotide,  Adaptor-3G-F ACTAGCTCGAGCATATGGGATCCrGrGrG

2 µL deionized water

Incubated at 72°C for 2 min

Immediately placed in an ice-water bath for 2 min.

Add 2 µL 5× first-strand synthesis buffer (250 mM Tris-HCl, pH 8.3, 30 mM MgCl2 , and 375 mM KCl), 1 µL dithiothreitol (DTT) (20 mM)

1 µL dNTP mixture (10 mM each dATP, dCTP, dGTP, and dTTP),

1 µL (200 U) MMLV reverse transcriptase (RNase H- point mutant).

Incubate at 42°C for 60 min

Put on ice.

Degrade RNA:

Add 1 µL 25 mM NaOH to the first-strand synthesis mixture

Incubating at 68°C for 30 min

PCR:

Mouse IgG2b Heavy Chain

mIgG2b-HC-PCR-R  TTGACCAGGCATCCCAGAGTC 

adaptor-BamH1-F actagCTCGAGcatatgggatccc

Adaptor-BamH1-F2    ACTAGCTCGAGCATATGGGATCC

Light Chain kapp

2495-kLC-Const-R 
TGTTAACTGCTCACTGGATGGTGG
(CCACCATCCAGTGAGCAGTTAACA)

adaptor-BamH1-F actagCTCGAGcatatgggatccc

Adaptor-BamH1-F2    ACTAGCTCGAGCATATGGGATCC

in 50-µL reaction containing: 40 mM Tricine-KOH, pH 9.2; 15 mM KOAc; 3.5 mM Mg(OAc)2 

1 ul of 10  µM 5′-anchor primer:adaptor-BamH1-F actagCTCGAGcatatgggatccc 

Adaptor-BamH1-F2    ACTAGCTCGAGCATATGGGATCC

1 ul of 10 µM gene specific primer; mIgG2b-HC-PCR-R  TTGACCAGGCATCCCAGAGTC 

1ul of 10 mM dNTP 

1 µL Advantage cDNA Polymerase Mix (50×; contains KlenTaq-1 and Deep Vent polymerases)

Smart kit:

(A): SMART Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ CDS primer 5'- AAGCAGTGGTATCAACGCAGAGTTTTTGTTTTTTTCTTTTTTTTTTVN -3' .

or (B) the GsuI option: SMART Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ SmartGsu T20 5’-AAGCAGTGGTATCAACGCAGAGTA(CTGGAG)d(T)20VN-3’

Oligo II oligonucleotide 5’-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3’ CDS primer 5'- AAGCAGTGGTATCAACGCAGAGTTTTTGTTTTTTTCTTTTTTTTTTVN -3'

SMART IV Oligonucleotide (12 μM) 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' CDS III/3' PCR Primer (12 μM) 5'-ATTCTAGAGGCCGAGGCGGCCGA

TdT Protocol

1st Strand

1st strand synthesis using and MMLV reverse transcriptase

Heavy Chain:

2490-mIgG2aHC-RT-R 
gttttgtgggtgctgagctc
(gagctcagcacccacaaaac)

or better with  

2494_mIgG2a-HC-RT-R2
GGTGTGCACACCTTCCCAG
(CTGGGAAGGTGTGCACACC)

Light Chain

2495-mIgG2a-kLC-RT-R	
GAAGCACACGACTGAGGCACC
(GGTGCCTCAGTCGTGTGCTTC)

2 ul (2 µg) purified total RNA;
1 µl of appropriate constant region primer (e.g., 0.5 ul of 2490-mIgG2aHC-RT-R + 0.5 ul  of 2495-mIgG2a-kLC-RT-R  )

1 ul 10 mM dNTP

Water to 15 ul

65 oC for 5 min.

Chill on ice.

Add 
4 µl 5× RT buffer

1 ul Maxima H min Enzyme Mix

Incubate at RT for 10 min, then 15 min at 50 oC

Another TdT Protocol

RT Reaction

1 ul MMLV:  40 U SuperScript™ III (Invitrogen)  containing 2 U RNaseOUT™ (Invitrogen)

1 ul of  2.5 mM dNTP (0.5 mM final)

 0.25 pmol each gene specific RT primers (mix). i.e.

1 ul of 0.25 uM oligo mix:

0.25 uM oligo mix: e.g., 1 ul of 1 uM primer A + 1 ul of  1 uM primer B  + 2 ul of H2O) 

1 ul of 5X RT Buffer

1X RT Buffer: 1.5 mM MgCl2, 37.5 mM KCl, 10 mM DTT, 0.25% Nonidet™ P-40 (NP40), and 0.1 mg/mL bovine serum albumin (BSA) in 25 mM TrisHCl, pH 8.3

in 5ul reaction

Incubate 1 h at 55°C

3' Tailing

To  the above reverse transcription reaction  add

1 μL of 10× tailing reaction reagents containing 100 mM MgCl2, 10 mM DTT, 100 mM Tris-HCl, pH 7.5

1 ul of 100 mM dGTP (2 mM)

1 ul TdT-->7.5 U terminal deoxynucleotidyl-transferase

2 ul water to final vol of 10 μL

Incubate 1 h at 37°C

NEB 1X Terminal Transferase Reaction Buffer (may not be compatible)
50 mM Potassium Acetate
20 mM Tris-acetate
10 mM Magnesium Acetate
pH 7.9 @ 25°C

Second-strand synthesis

dGTP-tailed cDNA is used without purification as a template for second strand cDNA synthesis. 
1.25 U Phusion
1 ul of 10 uM oligo(dC) adaptor 
1 ul 10 mM dNTP 
10 ul 5X Phusion Buffer

1 X94°C for 3 min

23 cycles: 
30 s at 94°C
30 s at 60°C
3 min at 72°C

PCR

5 ul of the 2nd Strand reaction

1 ul 10 uM nest primer F

1 ul 10 uM nest primer R

1 ul 10 mM dNTP

5 ul 5 X Phusion Buffer

1 ul Phusion

11 ul H2O

25 U RNasin Ribonuclease Inhibitor;
200 U M-MLV reverse transcriptase;

Before adding the rest of the reaction mixture, prepare the RNA and corresponding
constant region primer in a separate tube, and heat to 70 °C for 10 min, to disrupt any RNA
secondary structure that might have formed. After heating, place the tube immediately on ice
to prevent secondary structure reforming. RNA can form very stable secondary structures that
can markedly reduce the efficacy of reverse transcription. Add the rest of the reverse
transcriptase mix to the tube, mix gently, spin down, and incubate at 50 °C for 60 min. 

Purify using spin column (add 500 ul QG buffer), elute with 25 ul H2O

TdT tailing

Terminal Deoxyribonucleotide Transferase (Promega, Madison, WI, USA);
dNTP (e.g. dATP) (Fermentas, Vilnius, Lithuania). 
A homopolymeric tail is added to the 3’-end of the first-strand cDNA in a reaction that is
catalysed by terminal deoxynucleotidyl transferase (TdT) using only one of the possible four
dNTPs. Usually, 20-100 nucleotides are added to the DNA fragment in the tailing reaction,
and these represent a primer binding site for second-strand synthesis.
For addition of the poly(A) tail, prepare the following reaction mixture in a sterile
microcentrifuge tube on ice, in a total reaction volume of 20 µl:
5-10 µl purified first-strand cDNA (the optimal amount depends on the amount of RNA
used in the first-strand reaction and on the purification efficiency);

To the column purified (eluted from spin column) 1st cDNA:

Add
2.5 µl 5× TdTbuffer;

2.5 ul 2.5 mM CoCl2

1 ul 10 mM dGTP 
1 ul  TdT;

Incubate for 1 h at 37 °C, and then for 10 min at 70 °C, to inactivate the enzyme. Place the tube on ice.

Isolate the poly(A)-tailed cDNA with a DNA Purification kit.

TdT buffer is not compatible with the PCR buffer system, therefore the tailed cDNA has to be purified before PCR. 

PCR amplification of the Ig variable-region sequence 

2494_IgG2a-HL-Const-BamH1-F

actagCTCGAGcatatgggatccTTTTTTTTTTTTTTTTT

Heavy Chain

Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC

adaptor-BamH1-F actagCTCGAGcatatgggatccc

2494_IgG2a-HL-Const-R 
constant
GGTCAAGGTGACTGGCTCAGGGAA
(ttccctgagccagtcaccttgacc )

Light Chain kappa

2495-kLC-Const-R 
TGTTAACTGCTCACTGGATGGTGG
CCACCATCCAGTGAGCAGTTAACA)

Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC

adaptor-BamH1-F actagCTCGAGcatatgggatccc

PCR using Phusion Enzyme

Finally, the Ig-coding variable region is amplified in a PCR reaction using two primers:
one complementary to the 5’-end (constant region) and the other complementary to the
homopolymeric tail at the 3’-end of first-strand cDNA. Phusion HF polymerase
is preferred for RACE, due to its lower error rate.

Prepare the following PCR reaction mixture, in a total reaction volume of 50 µl:
10 µl 5× reaction buffer;
 
1 ul of 10  µM constant region primer 

(e.g. constant region primer  2494_IgG2a-HL-Const-R  GGTCAAGGTGACTGGCTCAGGGAA )

1 ul  of 1 uM Adaptor-polyC-F actagCTCGAGcatatgggatccCCCCCCCCCCCCC 

1 ul of 10 uM adaptor-BamH1-F actagCTCGAGcatatgggatccc

1ul of 10 µM dNTP mix;
1 ul Phusion  polymerase;
X ul Nuclease-free water. to 50 ul.
Incubate in a thermal cycler preheated to 95 °C, using the following conditions:
Initial denaturation at 95 °C for 5 min, followed by 33 cycles of:
95 °C for 1 min;
55 °C for 1 min;
68 °C for 1 min.
Incubate at 68 °C for 10 min, then cool to 4 °C and store at -20 °C. 

Inverted PCR Protocol

After oligo dT priming, ligate with 1 ul T4 ligase, then PCR:

 5'-GTCCACGAGGTGCTGCACAAT (IgG2-CH3, first primer), 5'-GTCACTGGCTCAGGGAAATAACC (IgG2-CHi, second primer); b) for IgGl heavy chain amplification: 5'-CCTGCTCTGTGTTACATGAGGG (IgGI-CH3, first primer), 5'-CCCAGGGTCACCATGGAGTTAG (IgGl-CH1, second primer); for kappa light chain amplification: 5'-AAGATGGATACAGTTGGTGC (K-CLA,first primer), 5'-TGTCAAGAGCTTCAACAGGA (K-CLB, second primer).  PCR product size=700~800 bp