Editing Tn5 Transposase

'''Tn5 Transposase Production''' 

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.<br> 

== Materials  ==

*pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)<br> * BL21(DE3)pLysS cells<br> * TEGX buffer<br> o 10 mM Tris-HCl pH 7.5<br> o 700 mM NaCl<br> o 1 mM EDTA<br> o 10% glycerol<br> o 0.1% Triton X-100

<br> * Storage buffer (Epicentre)<br> o 50% glycerol<br> o 50 mM Tris-HCl pH 7.5<br> o 100 mM NaCl<br> o 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action<br> o 1 mM DTT 

<br> 

== Protocol  ==

*Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight<br> o Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin <br> * Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.<br> * Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5<br> * Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours<br> * Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes<br> * Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor<br> * Sonicate 3x pausing 10 minutes between sonications with the cells on ice<br> * Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g<br> * Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)<br> * Wash the column with 100 ml cold TEGX buffer<br> * Load the cell supernatent onto the column and allow it to flow through<br> * Flow the supernatent past the column a second time<br> * Wash the column with 200 ml TEGX buffer<br> * Add 1 ml of 1M DTT to 20 ml of TEGX buffer<br> * Flow the 21 ml DTT + TEGX into the column<br> * Cap the column and hold at 4°C overnight<br> * Recover the protein with 10 ml TEGX buffer flowed through the column<br> * Recover a second 10 ml similarly<br> * Concentrate the protein by spinning in Centricon YM10<br> * Dilute concentrate with 40% glycerol to bring final to 50%<br> * Store aliquots at -80 and -20<br> * Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

<br> 

== Molarity  ==

*Gel runs at 55 KD, approximately correct for a 450 AA protein.<br> * Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 - 2.5 pmol<br> * 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng<br> * 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug<br> * 100 fmol transposon = 180 ng

<br> 

== DNA binding tests  ==

*Use constant 200 ng of DNA (dilute from 1 ug/ul stock)<br> * Use serial dilutions of protein starting at 8 ug/ul<br> o 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA <br> * Incubate 30 minutes at 37<br> * Run on 0.8% E-Gel<br> * DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX

<br> Tests 

<br> o 2 ul 116 ng/ul ME0 PCR DNA<br> o 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer<br> o incubate 1 hour 37C<br> o overnight at 4C 

Gel images<br> 

<br> 

*Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C<br> o this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase<br> o Concentrated to 20 ul and run on a 1.2% gel <br> * 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C<br> o this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

DNA binding and cutting tests 

*0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume<br> o done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA<br> o incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)<br> o results: near linear increase of cut out fragments with transposase molar excess of 0-9x

<br> 

Standard Epicentre reaction 

<br> 

*1 ul DNA (100 ng/ul) in TE<br> * 2 ul transposase<br> * 1 ul glycerol<br> * This is:<br> o about 100 fmol or less transposon DNA<br> o at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess<br> o 25 ng/ul final, so expect 1e4 or so transformants

To Do 

*Prep new Tn5 protein (on hold, unnecessary)<br> * quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)<br> * Make storage buffer, dilute existing stock into storage buffer (done)<br> * run&nbsp; style test of transposome formation (to do; initial gel unconvincing)<br> * Run&nbsp; style test of transposon cutting (to do)<br> * Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

<br>pWH1891 Sequence information 

*T7 and Intein-R primers, ATG start at 45<br> * Truncates aa's 1-4 from canonical sequence<br> * Mutations<br> o E54K -- improve binding to OE<br> o M56A -- eliminate start for C-terminal inhibitory protein<br> o L372P -- hyperactive mutation

&gt;pWH1891<br>CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC<br>GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT <br>AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG <br>CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA <br>TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT <br>GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG <br>TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA <br>GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA <br>CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG <br>AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA <br>TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG <br>GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG <br>AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC <br>AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT <br>TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT<br>TAATGGCGGATGGGTCTATGA 

<br> Testing the transposase 

*Transform 50 μl of E. coli Top10 electrocompetent cells with:<br> o Tn5 transposons (1 μl); plate out on Tet plates, count colonies<br> o pUC19 positive control 10 pg/μl; plate out on amp plates<br> o Electroporation at 2.5 KV in 2 mm gap cuvette<br> o pUC19 colonies visible in six hours under the microscope<br> o Tet resistant colonies are not visible at that time

<br>Notes 

*uses 100 mM hydroxylamine as a cleavage reagent instead of DTT

<br> 

[[Category:Protocols]]