Tn5 Transposase

Tn5 Transposase Production

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

Materials

• pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)
  * BL21(DE3)pLysS cells
  * TEGX buffer
  o 10 mM Tris-HCl pH 7.5
  o 700 mM NaCl
  o 1 mM EDTA
  o 10% glycerol
  o 0.1% Triton X-100

* Storage buffer (Epicentre)
o 50% glycerol
o 50 mM Tris-HCl pH 7.5
o 100 mM NaCl
o 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action
o 1 mM DTT

Protocol

• Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight
  o Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin
  * Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.
  * Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5
  * Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours
  * Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes
  * Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor
  * Sonicate 3x pausing 10 minutes between sonications with the cells on ice
  * Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g
  * Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
  * Wash the column with 100 ml cold TEGX buffer
  * Load the cell supernatent onto the column and allow it to flow through
  * Flow the supernatent past the column a second time
  * Wash the column with 200 ml TEGX buffer
  * Add 1 ml of 1M DTT to 20 ml of TEGX buffer
  * Flow the 21 ml DTT + TEGX into the column
  * Cap the column and hold at 4°C overnight
  * Recover the protein with 10 ml TEGX buffer flowed through the column
  * Recover a second 10 ml similarly
  * Concentrate the protein by spinning in Centricon YM10
  * Dilute concentrate with 40% glycerol to bring final to 50%
  * Store aliquots at -80 and -20
  * Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

Molarity

• Gel runs at 55 KD, approximately correct for a 450 AA protein.
  * Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 - 2.5 pmol
  * 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng
  * 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug
  * 100 fmol transposon = 180 ng

DNA binding tests

• Use constant 200 ng of DNA (dilute from 1 ug/ul stock)
  * Use serial dilutions of protein starting at 8 ug/ul
  o 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA
  * Incubate 30 minutes at 37
  * Run on 0.8% E-Gel
  * DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX

Tests

o 2 ul 116 ng/ul ME0 PCR DNA
o 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer
o incubate 1 hour 37C
o overnight at 4C

Gel images

• Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C
  o this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase
  o Concentrated to 20 ul and run on a 1.2% gel
  * 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C
  o this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

DNA binding and cutting tests

• 0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume
  o done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA
  o incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)
  o results: near linear increase of cut out fragments with transposase molar excess of 0-9x

Standard Epicentre reaction

• 1 ul DNA (100 ng/ul) in TE
  * 2 ul transposase
  * 1 ul glycerol
  * This is:
  o about 100 fmol or less transposon DNA
  o at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess
  o 25 ng/ul final, so expect 1e4 or so transformants

To Do

• Prep new Tn5 protein (on hold, unnecessary)
  * quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
  * Make storage buffer, dilute existing stock into storage buffer (done)
  * run  style test of transposome formation (to do; initial gel unconvincing)
  * Run  style test of transposon cutting (to do)
  * Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

pWH1891 Sequence information

• T7 and Intein-R primers, ATG start at 45
  * Truncates aa's 1-4 from canonical sequence
  * Mutations
  o E54K -- improve binding to OE
  o M56A -- eliminate start for C-terminal inhibitory protein
  o L372P -- hyperactive mutation

>pWH1891
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC
GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT
AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG
CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA
TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT
GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG
TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA
GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA
CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG
AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA
TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG
GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG
AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC
AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT
TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT
TAATGGCGGATGGGTCTATGA

Testing the transposase

• Transform 50 μl of E. coli Top10 electrocompetent cells with:
  o Tn5 transposons (1 μl); plate out on Tet plates, count colonies
  o pUC19 positive control 10 pg/μl; plate out on amp plates
  o Electroporation at 2.5 KV in 2 mm gap cuvette
  o pUC19 colonies visible in six hours under the microscope
  o Tet resistant colonies are not visible at that time

Notes

• uses 100 mM hydroxylamine as a cleavage reagent instead of DTT