Editing
Yijia LI 2 2 2018
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
== Cloning == {| border="1" cellspacing="1" cellpadding="1" style="width: 675px;" |- | ID | # | Name | style="width: 132px;" | Status | style="width: 193px;" | Note | style="width: 111px;" | Note2 | style="width: 144px;" | Note3 |- | 3129 | 1 | pMiniT2 | style="width: 132px;" | sequencing | style="width: 193px;" | sequncing: good, but looks like missing ut digestion does show Kpn1 -BamH1 sites<br/> | style="width: 111px;" | target construct pCMV5-HA-VH-mIgG2b<br/> | style="width: 144px;" | need to subclone 2492 pCMV5-mIgG2b-HC |- | 3075 | 1 | pCMV | style="width: 132px;" | sequencing | style="width: 193px;" | good | style="width: 111px;" | good | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |- | <br/> | <br/> | <br/> | style="width: 132px;" | <br/> | style="width: 193px;" | <br/> | style="width: 111px;" | <br/> | style="width: 144px;" | <br/> |} Date:2/2/2018 Digest of PCR products '''3010 pCMV5-Flag-kappa, Flag light''' Gene Synthesize need to fix from 3135-4-pMiniT2 >as-F_E12.ab1 template it is actually 3010: missing 5' end ATCATCGGATCCGCC 3' end: GGAGGAACAAAGCTCGAGATCAAGCGGGCTAGCGGTACCATCATC using these oligos Insert: 1 ul of 10 uM 3010-Flag-VL-1C4ATCATCGGATCCGCCGCCACCATG 1 ul of 1 uM 3010-Flag-VL-2C5AGAGCAGCAGGAGCCCCAGGAGCTGAGCGGGGACCCTCATGTCCATGGTGGCGGCGGA 1 ul of 1 uM 3010-Flag-VL-11D2CGCTCCTTACACCTTTGGCGGAGGAACAAAGCTCGAGATCAAGCGGGCTAGCGGTACC 1 ul of 10 uM 3010-Flag-VL-12D3GATGATGGTACCGCTAGCCCGC '''3135-4-pMiniT2 as template''' Vector Name: 2493 pCMV5-mIgG-kLC Restriction Enzymes: BamH1-Kpn1 [[File:3010 3003 3011 H&L.JPG|RTENOTITLE]] [[File:3151 pMiniT2 TEST.JPG|RTENOTITLE]] [[File:Gel purfication digest.JPG|RTENOTITLE]] [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST) [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== Date:2/5/2018 subcloning subclone of 3009-4_2492 [[File:3009-4 2492.JPG|RTENOTITLE]] Date:2/5/2018 PCR cloning Digest of Vector 2492_2493 [[File:2492 2493.JPG|RTENOTITLE]] Date:2/5/2018 BamHI Test [[File:BamhI test.JPG|RTENOTITLE]] Date:2/5/2018 PCR Cloning of 3129_3130 3130 Fix and 3021 test '''3129 pCMV5-HA-VH-mIgG2b, heavy''' Vector Name: 2492 pCMV5-mIgG2b-HC PCR from '''3011 pJet1.2-HA''' Heavy chain Clone into pMiniT2 Subclone into 2492 pCMV5-mIgG2b-HC Restriction Enzymes: BamH1 - Kpn1 10:30, 6 February 2018 (EST)10:30, 6 February 2018 (EST) '''3130 pCMV5-HA-VL-mIgKappa HA light''' Vector Name: 2493 pCMV5-mIgG-kLC PCR from 3011 pJet1.2-HA light chain Clone: 3011-L-1 Restriction Enzymes: BamH1-Kpn1 10:30, 6 February 2018 (EST) 3130-Fix and 3021 are for sequencing test,because the result showed no primering Annealing:55oC Note: 3129-BamH1-F atcatcggatccAAGATCTAGAGCCGCCACCATG 3129-Kpn1-F atcatcGTACCagacacggtaaccagtgttc (gaacactggttaccgtgtctGGTACgatgat) 3130-BamH1-R atcatcggatccGCCGCCACCATGGACATGAGGGTC 3130-Kpn1-R atcatcGGTACCccgcttcagttccagcttggttccgccgccaaatg (catttggcggcggaaccaagctggaactgaagcggGGTACC gatgat) [[User:Crm|Crm]] ([[User_talk:Crm|talk]]) 10:30, 6 February 2018 (EST) '''Figure description''' 3129 # 1,2,: Use Platinum HiFi PCR 2X mix 3130 # 3: Use DreamTaq 2X Mix 3130-fix: Dream Taq 2X mix, using pMiniT2 F & R primers, testing why we got no priming in sequencing exp 3021 using pMiniT2 F & R primers, testing why we got no priming in sequencing exp [[File:3129 3130.JPG|RTENOTITLE]] [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)[[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]])== [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== Date:2/6/2018 PCR Cloning of '''3129''' '''Figure despriction''' Template: 3011 H in pJet1.2, sequenced, annealing: 55 oC 30'', Extension 72 oC 30'' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | Lane | Primers | Enzyme |- | Ladder | <br/> | |- | 1 | 3129-F + 3129-R<br/> | DreamTaq<br/> |- | 2 | pJet1.2 F + R | DreamTaq |- | 3 | 3129-F + 3129-R<br/> | Plantimum PCR Supermix HF<br/> |- | 4 | pJet1.2 F + R<br/> | Plantimum PCR Supermix HF<br/> |- | 5 | 3129-F + 3129-R<br/> | Q5 DNA polymerase |- | 6 | pJet1.2 F + R<br/> | Q5 DNA polymerase<br/> |} [[File:PCR for 3011(Paul).JPG|RTENOTITLE]] [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)~=== [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== Date;2/6/2018 PCR: Test the result of sequencing;<span style="color: rgb(37, 37, 37); font-family: sans-serif; font-size: 14px; background-color: rgb(255, 255, 255);"> annealing: 55 oC 30</span>'', Extension 72 oC 30'' '''Figure Despriction''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | template | 2X PCR Mix | Primer |- | 1 | + Control---3011 H | DreamTaq | 3129 F&R |- | 2 | 3021-2 | <div>DreamTaq</div> | pMiniT2 |- | 3 | 3021-1 | DreamTaq | pMiniT2 |- | 4 | 3130-Fix-1 | DreamTaq | pMiniT2 |} '''Result: the 3021-1,3021-2,3130-Fix-1 are contaminted, so we abandoned them.''' [[File:Test for no primering sequencing.JPG|RTENOTITLE]] <font color="#333333" face="sans-serif, Arial, Verdana, Trebuchet MS"><span style="font-size: 13px; background-color: rgb(255, 255, 255);">Date:2/6/2018</span></font> '''Figure Despriction''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Template | 2X PCR Mix | Primer |- | 1 | 3011-H (control) | DreamTaq | 3129 F&R |- | 2 | 3011 L | Plantinum PCR Super mix HiFi | 3130 F&R |- | 3 | 3011 L | Q5 DNA Polymerase | 3130 F&R |- | 4 | 3011 H | Plantinum PCR Super mix HiFi<br/> | 3129 F&R |- | 5 | 3011 H | Plantinum PCR Super mix HiFi<br/> | 3129 F&R |} [[File:PCR of 3011L 3011H.JPG|RTENOTITLE]] === This page contains the following errors: === <div style="font-family:monospace;font-size:12px">error on line 1 at column 4830: attributes construct error</div> === Below is a rendering of the page up to the first error. === </parsererror> [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)[[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)=== [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== Date:2/7/2018 '''Figure Description''' PCR of different Taq enzymes {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Template | 2X PCR Mix | Primer |- | 1 | 3011 H(+) | DreamTaq | pMini T2 |- | 2 | 3011 H | DreamTaq | pMIniT2 |- | 3 | 3011 H | PCR MIx | pMIniT2 |- | 4 | 3011 H | 0.1Taq | pMIniT2 |- | 5 | 3011 H | DreamTaq | 3129 F&R |} '''Results: We didn't get good results.''' [[File:Test of different products.JPG|RTENOTITLE]] '''Figure Despriction''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Template | 2X PCR | Primer |- | 1 | 3011 H | DreamTaq | 3129 F&R |- | 2 | 3011 H | DreamTaq | pMiniT2 |- | 3 | 3011 H | PCR Mix | pMiniT2 |- | 4 | 3011 L | 0.1 Taq | pMiniT2 |- | 5 | 3011 L | PCR Mix | 3130 F&R |- | 6 | 3011 L | 0.1 Taq | 3130 F&R |} [[File:PCR of different enzymes 2.JPG|RTENOTITLE]] '''Figure Despriction: ''' '''Annealing:55oC, Extension:30s,''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Template | 2X PCR Mix | Primers |- | 1 | 3011 L | phusion | pMini T2 F&R |- | 2 | <div>3011 L</div> | phusion | pMini T2 F&R<br/> |- | 3 | 3011 L<br/> | phusion | pMini T2 F&R<br/> |- | 4 | 3011 L<br/> | phusion | pMini T2 F&R<br/> |- | 5 | 3011 L | kfu | pMini T2 F&R<br/> |- | 6 | 3011 L | kfu | pMini T2 F&R<br/> |- | 7 | 3011 L<br/> | kfu | pMini T2 F&R<br/> |- | 8 | 3011 L<br/> | kfu | pMini T2 F&R<br/> |- | 9 | 3011 L<br/> | KOD | pMini T2 F&R<br/> |- | 10 | 3011 L<br/> | KOD | pMini T2 F&R<br/> |- | 11 | 3011 L<br/> | KOD | pMini T2 F&R<br/> |- | 12 | 3011 L | KOD | pMini T2 F&R<br/> |- | 13 | 3011 L | 0.5ul Taq+ 0.5ul pfu | pMini T2 F&R<br/> |- | 14 | 3011 L | 0.5ul Taq+ 0.5ul pfu<br/> | pMini T2 F&R<br/> |- | 15 | 3011 L(-) | no DNA polymerase | pMini T2 F&R<br/> |} [[File:Polymerase QC for using PCR.JPG|RTENOTITLE]] '''Results: The enzymes may not work.''' [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)[[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST) [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== '''Date:2/8/2018''' '''Figure Despriction''' '''Digestion of 3011 L_3011 H''' http://www.excellgen.net/eln/images/3/3e/Digestion_of_3011_L_3011_H.JPG '''Result:#1,#2,#4,#5,#7,#8 has bands. So we did PCR for these samples.''' '''Figure Despriction''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Tempate | 2X PCR Mix | Primer |- | 1 | 3011 L (For 3130) | 0.1 Taq | pMiniT2 F&R |- | 2 | 3011 L | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 4 | 3011 L | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 5 | 3011 L | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 6 | 3011 H(For 3129) | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 7 | 3011 H | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 8 | 3011 H | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 9 | 3011 H | 0.1 Taq<br/> | pMiniT2 F&R<br/> |- | 10 | 3011 H(+) | 0.1 Ta1 |} [[File:PCR of Mini Prep for 3130 and 3129.JPG|RTENOTITLE]] Result: we picked #1,#8 to do sequencing. #1 is no primering.#8 is missing C in Kpn I. Friday,2/9/2018, we ordered another sequencing for #4. '''Figure Despriction''' '''Subclone of 3009''' Subclone from 3009-4-pMiniT2, Vector from 2492 [[File:Subclone 3009-4 2492.JPG|RTENOTITLE]] Result:cut the bands and do ligation. [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)=== [[User:Paul.xu|Paul.xu]] ([[User talk:Paul.xu|talk]]) 17:16, 13 February 2018 (EST)== Date:2/9/2018 '''Protein purfication: 15 samples.''' '''Use buffer B to elute''' '''Concentration:''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Concentration |- | 1 | -0.53 |- | 2 | 0.48 |- | 3 | 1.59 |- | 4 | 2.24 |- | 5 | 1.26 |- | 6 | 1.87 |- | 7 | 1.17 |- | 8 | 0.63 |- | 9 | 0.50 |- | 10 | 0.30 |- | 11 | 0.53 |- | 12 | 0.29 |- | 13 | 0.14 |- | 14 | 0.11 |- | 15 | 0.09 |} '''PCR Gene synthesis -----3010''' {| border="1" cellspacing="1" cellpadding="1" style="width: 778px;" |- | # | Tempate | style="width: 111px;" | Oligo | style="width: 174px;" | 2X PCR Mix | style="width: 46px;" | Primer | style="width: 307px;" | Note |- | 1 | 3135-4 | style="width: 111px;" | 3010-D1,D2,D3<br/> | style="width: 174px;" | Platinum 2X SuperMix HiFi | style="width: 46px;" | C4,C5,C6 | style="width: 307px;" | C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM |- | 2 | 3135-4 <br/> | style="width: 111px;" | 3010-D1,D2,D3<br/> | style="width: 174px;" | Platinum 2X SuperMix HiFi<br/> | style="width: 46px;" | C4,C5,C6<br/> | style="width: 307px;" | C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM |- | 3 | 3135-4 <br/> | style="width: 111px;" | 3010-D1,D2,D3<br/> | style="width: 174px;" | Platinum 2X SuperMix HiFi<br/> | style="width: 46px;" | C4,C5,C6<br/> | style="width: 307px;" | C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM<br/> |- | 4 | 3135-4 (+) | style="width: 111px;" | 3010-C6,D1<br/> | style="width: 174px;" | Platinum 2X SuperMix HiFi<br/> | style="width: 46px;" | C6.D1 | style="width: 307px;" | C6,D1---10uM |} [[File:PCR of 3010 gene synthesis.JPG|RTENOTITLE]] '''PCR Gene synthesis -----3001''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Oligo | 2X PCR Mix | Primer | Note |- | 1 | 3001 Oligo Mix | Q5 | E6,F5 | <br/> |- | 2 | 3001 Oligo Mix<br/> | Q5 | E6,F5 | <br/> |- | 3 | 3001 Oligo Mix<br/> | Q5 | E6,F5 | <br/> |- | 4 | 3001 Oligo Mix<br/> | Q5 | E6,F5 | <br/> |} <div></div [[File:PCR of 3001 gene synthesis.JPG|RTENOTITLE]] '''Result: we didn't synthesiz ''''''3001'''''' successfully.''' '''Colony screening for 3009 subclone''' '''Figure Desperction''' {| border="1" cellspacing="1" cellpadding="1" style="width:500px;" |- | # | Template | 2X PCR Mix | Primer |- | 1 | 3009-1 | 0.1Taq | pMiniT2 F&R |- | 2 | 3009-2 | ..... | ............ |- | 3 | 3009-3 | ..... | ............. |- | 4 | 3009-4 | ..... | .............. |- | 5 | 3009-5 | ..... | .............. |- | 6 | 3009-6 | ..... | ............. |- | 7 | 3009-7 | ..... | ............. |- | 8 | 3009-8 | ..... | .............. |- | 9 | 3009-9 | ..... | ................. |- | 10 | 3009-10 | ..... | .................... |- | + | 3011 L | 0.1Taq | pMiniT2 F&R |} [[File:Colony screening.JPG|RTENOTITLE]] </div>[[Category:My ELN]]
Summary:
Please note that all contributions to ELN may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ELN:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Category:
Main page
To Do
Tasks
My ELN
Weekly Reports
Buffer Recipe
SOP
Protocols
Inventories
Projects
Products
Customers
Contacts
Suppliers
Vectors
Vector Map
Clones
Cloning
Sequencing
NGS
Protein Expression
Purchaseing
QC
293 Expression
CHO Expression
Sf9 Expression
Protein Purification
Stem Cells
Cytokines
Protein Kinases
GPCR
Cell Lines
Competent Cells
Viral Proteins
VLP
Baculovirus
AAV
Adenovirus
Lentivirus
Virus Titering
Antibodies
Transfection
ELISA
qPCR RT-PCR
ImmunoAssay
Multiplex BioAssa
Lateral_Flow
Conjugation
Compounds Synthesis
BioEngineering
GenomeEngineering
Services
Software
Ideas
Links
Knowledgebase
Employees
Company
Tools
What links here
Related changes
Page information
Navigation
Special pages