Yijia LI 2 2 2018
Cloning
[edit]| ID | # | Name | Status | Note | Note2 | Note3 |
| 3129 | 1 | pMiniT2 | sequencing | sequncing: good, but looks like missing ut digestion does show Kpn1 -BamH1 sites |
target construct pCMV5-HA-VH-mIgG2b |
need to subclone 2492 pCMV5-mIgG2b-HC |
| 3075 | 1 | pCMV | sequencing | good | good | |
Date:2/2/2018
Digest of PCR products
3010 pCMV5-Flag-kappa, Flag light
Gene Synthesize
need to fix from 3135-4-pMiniT2 >as-F_E12.ab1 template it is actually 3010: missing 5' end ATCATCGGATCCGCC 3' end: GGAGGAACAAAGCTCGAGATCAAGCGGGCTAGCGGTACCATCATC using these oligos
Insert: 1 ul of 10 uM 3010-Flag-VL-1C4ATCATCGGATCCGCCGCCACCATG 1 ul of 1 uM 3010-Flag-VL-2C5AGAGCAGCAGGAGCCCCAGGAGCTGAGCGGGGACCCTCATGTCCATGGTGGCGGCGGA 1 ul of 1 uM 3010-Flag-VL-11D2CGCTCCTTACACCTTTGGCGGAGGAACAAAGCTCGAGATCAAGCGGGCTAGCGGTACC 1 ul of 10 uM 3010-Flag-VL-12D3GATGATGGTACCGCTAGCCCGC
3135-4-pMiniT2 as template
Vector Name: 2493 pCMV5-mIgG-kLC
Restriction Enzymes: BamH1-Kpn1
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST) Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date:2/5/2018 subcloning subclone of 3009-4_2492
Date:2/5/2018
PCR cloning Digest of Vector 2492_2493
Date:2/5/2018
BamHI Test
Date:2/5/2018 PCR Cloning of 3129_3130 3130 Fix and 3021 test
3129 pCMV5-HA-VH-mIgG2b, heavy
Vector Name: 2492 pCMV5-mIgG2b-HC
PCR from 3011 pJet1.2-HA Heavy chain
Clone into pMiniT2
Subclone into 2492 pCMV5-mIgG2b-HC
Restriction Enzymes: BamH1 - Kpn1
10:30, 6 February 2018 (EST)10:30, 6 February 2018 (EST)
3130 pCMV5-HA-VL-mIgKappa HA light
Vector Name: 2493 pCMV5-mIgG-kLC
PCR from 3011 pJet1.2-HA light chain
Clone: 3011-L-1
Restriction Enzymes: BamH1-Kpn1
10:30, 6 February 2018 (EST)
3130-Fix and 3021 are for sequencing test,because the result showed no primering
Annealing:55oC
Note:
3129-BamH1-F atcatcggatccAAGATCTAGAGCCGCCACCATG
3129-Kpn1-F atcatcGTACCagacacggtaaccagtgttc (gaacactggttaccgtgtctGGTACgatgat)
3130-BamH1-R atcatcggatccGCCGCCACCATGGACATGAGGGTC
3130-Kpn1-R atcatcGGTACCccgcttcagttccagcttggttccgccgccaaatg (catttggcggcggaaccaagctggaactgaagcggGGTACC gatgat) Crm (talk) 10:30, 6 February 2018 (EST)
Figure description
3129 # 1,2,: Use Platinum HiFi PCR 2X mix
3130 # 3: Use DreamTaq 2X Mix
3130-fix: Dream Taq 2X mix, using pMiniT2 F & R primers, testing why we got no priming in sequencing exp
3021 using pMiniT2 F & R primers, testing why we got no priming in sequencing exp
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)Paul.xu (talk)== Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date:2/6/2018
PCR Cloning of 3129
Figure despriction Template: 3011 H in pJet1.2, sequenced, annealing: 55 oC 30, Extension 72 oC 30
| Lane | Primers | Enzyme |
| Ladder | ||
| 1 | 3129-F + 3129-R |
DreamTaq |
| 2 | pJet1.2 F + R | DreamTaq |
| 3 | 3129-F + 3129-R |
Plantimum PCR Supermix HF |
| 4 | pJet1.2 F + R |
Plantimum PCR Supermix HF |
| 5 | 3129-F + 3129-R |
Q5 DNA polymerase |
| 6 | pJet1.2 F + R |
Q5 DNA polymerase |
.JPG)
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)~=== Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date;2/6/2018
PCR: Test the result of sequencing; annealing: 55 oC 30, Extension 72 oC 30
Figure Despriction
| # | template | 2X PCR Mix | Primer |
| 1 | + Control---3011 H | DreamTaq | 3129 F&R |
| 2 | 3021-2 | DreamTaq
|
pMiniT2 |
| 3 | 3021-1 | DreamTaq | pMiniT2 |
| 4 | 3130-Fix-1 | DreamTaq | pMiniT2 |
Result: the 3021-1,3021-2,3130-Fix-1 are contaminted, so we abandoned them.
Date:2/6/2018
Figure Despriction
| # | Template | 2X PCR Mix | Primer |
| 1 | 3011-H (control) | DreamTaq | 3129 F&R |
| 2 | 3011 L | Plantinum PCR Super mix HiFi | 3130 F&R |
| 3 | 3011 L | Q5 DNA Polymerase | 3130 F&R |
| 4 | 3011 H | Plantinum PCR Super mix HiFi |
3129 F&R |
| 5 | 3011 H | Plantinum PCR Super mix HiFi |
3129 F&R |
This page contains the following errors:
[edit]Below is a rendering of the page up to the first error.
[edit]</parsererror>
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)Paul.xu (talk) 17:16, 13 February 2018 (EST)=== Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date:2/7/2018
Figure Description
PCR of different Taq enzymes
| # | Template | 2X PCR Mix | Primer |
| 1 | 3011 H(+) | DreamTaq | pMini T2 |
| 2 | 3011 H | DreamTaq | pMIniT2 |
| 3 | 3011 H | PCR MIx | pMIniT2 |
| 4 | 3011 H | 0.1Taq | pMIniT2 |
| 5 | 3011 H | DreamTaq | 3129 F&R |
Results: We didn't get good results.
Figure Despriction
| # | Template | 2X PCR | Primer |
| 1 | 3011 H | DreamTaq | 3129 F&R |
| 2 | 3011 H | DreamTaq | pMiniT2 |
| 3 | 3011 H | PCR Mix | pMiniT2 |
| 4 | 3011 L | 0.1 Taq | pMiniT2 |
| 5 | 3011 L | PCR Mix | 3130 F&R |
| 6 | 3011 L | 0.1 Taq | 3130 F&R |
Figure Despriction:
Annealing:55oC, Extension:30s,
| # | Template | 2X PCR Mix | Primers |
| 1 | 3011 L | phusion | pMini T2 F&R |
| 2 | 3011 L
|
phusion | pMini T2 F&R |
| 3 | 3011 L |
phusion | pMini T2 F&R |
| 4 | 3011 L |
phusion | pMini T2 F&R |
| 5 | 3011 L | kfu | pMini T2 F&R |
| 6 | 3011 L | kfu | pMini T2 F&R |
| 7 | 3011 L |
kfu | pMini T2 F&R |
| 8 | 3011 L |
kfu | pMini T2 F&R |
| 9 | 3011 L |
KOD | pMini T2 F&R |
| 10 | 3011 L |
KOD | pMini T2 F&R |
| 11 | 3011 L |
KOD | pMini T2 F&R |
| 12 | 3011 L | KOD | pMini T2 F&R |
| 13 | 3011 L | 0.5ul Taq+ 0.5ul pfu | pMini T2 F&R |
| 14 | 3011 L | 0.5ul Taq+ 0.5ul pfu |
pMini T2 F&R |
| 15 | 3011 L(-) | no DNA polymerase | pMini T2 F&R |
Results: The enzymes may not work.
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)Paul.xu (talk) 17:16, 13 February 2018 (EST) Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date:2/8/2018 Figure Despriction
Digestion of 3011 L_3011 H
http://www.excellgen.net/eln/images/3/3e/Digestion_of_3011_L_3011_H.JPG
Result:#1,#2,#4,#5,#7,#8 has bands. So we did PCR for these samples.
Figure Despriction
| # | Tempate | 2X PCR Mix | Primer |
| 1 | 3011 L (For 3130) | 0.1 Taq | pMiniT2 F&R |
| 2 | 3011 L | 0.1 Taq |
pMiniT2 F&R |
| 4 | 3011 L | 0.1 Taq |
pMiniT2 F&R |
| 5 | 3011 L | 0.1 Taq |
pMiniT2 F&R |
| 6 | 3011 H(For 3129) | 0.1 Taq |
pMiniT2 F&R |
| 7 | 3011 H | 0.1 Taq |
pMiniT2 F&R |
| 8 | 3011 H | 0.1 Taq |
pMiniT2 F&R |
| 9 | 3011 H | 0.1 Taq |
pMiniT2 F&R |
| 10 | 3011 H(+) | 0.1 Ta1 |
Result: we picked #1,#8 to do sequencing. #1 is no primering.#8 is missing C in Kpn I.
Friday,2/9/2018, we ordered another sequencing for #4.
Figure Despriction
Subclone of 3009
Subclone from 3009-4-pMiniT2,
Vector from 2492
Result:cut the bands and do ligation.
Paul.xu (talk) 17:16, 13 February 2018 (EST)== 17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)17:16, 13 February 2018 (EST)=== Paul.xu (talk) 17:16, 13 February 2018 (EST)==
Date:2/9/2018
Protein purfication: 15 samples.
Use buffer B to elute
Concentration:
| # | Concentration |
| 1 | -0.53 |
| 2 | 0.48 |
| 3 | 1.59 |
| 4 | 2.24 |
| 5 | 1.26 |
| 6 | 1.87 |
| 7 | 1.17 |
| 8 | 0.63 |
| 9 | 0.50 |
| 10 | 0.30 |
| 11 | 0.53 |
| 12 | 0.29 |
| 13 | 0.14 |
| 14 | 0.11 |
| 15 | 0.09 |
PCR Gene synthesis -----3010
| # | Tempate | Oligo | 2X PCR Mix | Primer | Note |
| 1 | 3135-4 | 3010-D1,D2,D3 |
Platinum 2X SuperMix HiFi | C4,C5,C6 | C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM |
| 2 | 3135-4 |
3010-D1,D2,D3 |
Platinum 2X SuperMix HiFi |
C4,C5,C6 |
C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM |
| 3 | 3135-4 |
3010-D1,D2,D3 |
Platinum 2X SuperMix HiFi |
C4,C5,C6 |
C4--10uM,C5,C6,D1,D3--0.5uM,D3--10uM |
| 4 | 3135-4 (+) | 3010-C6,D1 |
Platinum 2X SuperMix HiFi |
C6.D1 | C6,D1---10uM |
PCR Gene synthesis -----3001
| # | Oligo | 2X PCR Mix | Primer | Note |
| 1 | 3001 Oligo Mix | Q5 | E6,F5 | |
| 2 | 3001 Oligo Mix |
Q5 | E6,F5 | |
| 3 | 3001 Oligo Mix |
Q5 | E6,F5 | |
| 4 | 3001 Oligo Mix |
Q5 | E6,F5 |
Result: we didn't synthesiz '3001' successfully.
Colony screening for 3009 subclone
Figure Desperction
| # | Template | 2X PCR Mix | Primer |
| 1 | 3009-1 | 0.1Taq | pMiniT2 F&R |
| 2 | 3009-2 | ..... | ............ |
| 3 | 3009-3 | ..... | ............. |
| 4 | 3009-4 | ..... | .............. |
| 5 | 3009-5 | ..... | .............. |
| 6 | 3009-6 | ..... | ............. |
| 7 | 3009-7 | ..... | ............. |
| 8 | 3009-8 | ..... | .............. |
| 9 | 3009-9 | ..... | ................. |
| 10 | 3009-10 | ..... | .................... |
| + | 3011 L | 0.1Taq | pMiniT2 F&R |
