Hot Start PCR QC: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

20 February 2017

  • curprev 16:2716:27, 20 February 2017 Paul.xu talk contribs 1,879 bytes +1,879 Created page with "=== '''TREC''' === '''TREC_HDimer_F''' 5'-CACATCCCTTTCAACCATGCTG -3' LENGTH 22 GC CONTENT 50 % MEL TTEMP 56.6 ºC '''TREC_HDimer_R''' AGGGCCCGTGCCAGCTGCAG LENGTH..."
Retrieved from "https://eln.excellgen.com/index.php?title=Hot_Start_PCR_QC"