User contributions for Paul.xu

20 July 2016

• 22:1222:12, 20 July 2016 diff hist +33 N Synthesis Lipids Paul.xu moved page Synthesis Lipids to Synthesis of Lipids current
• 22:1222:12, 20 July 2016 diff hist +27,744 m Synthesis of Lipids Paul.xu moved page Synthesis Lipids to Synthesis of Lipids current
• 19:1419:14, 20 July 2016 diff hist 0 File:Synthesis of 3,4-Di(oleyloxy) Benzoic Acid.png Paul.xu uploaded a new version of File:Synthesis of 3,4-Di(oleyloxy) Benzoic Acid.png current
• 18:1918:19, 20 July 2016 diff hist +7,419 Synthesis of MVL5 No edit summary current
• 18:0318:03, 20 July 2016 diff hist 0 N File:MVL5 Transfection efficiency.png No edit summary current
• 17:4117:41, 20 July 2016 diff hist +43,152 Synthesis Lipophilic Polyamines No edit summary current
• 17:1017:10, 20 July 2016 diff hist +2,393 Transfection20160630 No edit summary current
• 17:0717:07, 20 July 2016 diff hist +125 N Nanoparticles Created page with "http://www.jove.com/video/3612/therapeutic-gene-delivery-transfection-human-pancreatic-cancer-cells Category:Transfection" current
• 16:0316:03, 20 July 2016 diff hist 0 N File:MVL5 synthsis.png No edit summary current
• 15:5115:51, 20 July 2016 diff hist 0 N File:Synthesis of building block.png No edit summary current
• 15:5115:51, 20 July 2016 diff hist 0 N File:MVL5 1.png No edit summary current
• 15:3815:38, 20 July 2016 diff hist 0 N File:Mvl5.png No edit summary current
• 15:3515:35, 20 July 2016 diff hist +9,630 Synthesis-of-dendritic-lipid No edit summary current
• 11:0811:08, 20 July 2016 diff hist 0 N File:Synthesis-of-the-dendritic-lipid-MVLBG2-starting-from-ornithine-methyl-ester.png No edit summary current

19 July 2016

• 16:2816:28, 19 July 2016 diff hist +22 N One Step RT-PCR Created page with "Category:Protocols" current
• 16:0316:03, 19 July 2016 diff hist +5,482 N RNA from Plants Created page with "'''Reagents''' •Liquid nitrogen<br/>•Extraction buffer: 0.25 M NaCl, 0.05 M Tris-HCl (pH 7.5), 20 mM EDTA, 1% (w/v) sodium dodecyl sulphate (SDS) and 4% (w/v) PVP (M.W. 3..." current

17 July 2016

• 09:4609:46, 17 July 2016 diff hist +393 Enzymes for RT-PCR No edit summary current

1 July 2016

• 18:1618:16, 1 July 2016 diff hist +3,975 Synthesis of GeneExpresso No edit summary current
• 17:4217:42, 1 July 2016 diff hist +54 N Transfection reagent comparison Paul.xu moved page Transfection reagent comparison to Transfection reagent comparison 2016 7 1 current
• 16:4516:45, 1 July 2016 diff hist +728 Tat-Cre Recombinase QC No edit summary current
• 14:5814:58, 1 July 2016 diff hist +6,224 Taq Purification Excellgen No edit summary current

30 June 2016

• 19:0019:00, 30 June 2016 diff hist +225 N Taq Polymerase QC Created page with "3_11_2013    B03    CMV-seq-F    CGCAAATGGGCGGTAGGCGTG 10_2_2012    A12    BGHpA-seq-R  ..." current
• 18:5118:51, 30 June 2016 diff hist +26 N 20160622Taq Paul.xu moved page 20160622Taq to Taq 20160622 current
• 18:5118:51, 30 June 2016 diff hist +96 m Taq 20160622 Paul.xu moved page 20160622Taq to Taq 20160622 current
• 12:4612:46, 30 June 2016 diff hist +4,451 Synthesis of DSP and DTBP No edit summary current

27 June 2016

• 16:5616:56, 27 June 2016 diff hist +578 N Synthesis PHP-CBA-DSP-PEI18 SOP Created page with "== Synthesis PHP-DSP-PEI SOP == PEI18: 4g/6 ml H2O (666 mg/ml) 1.5 g solid 1,3-Diamino-2-propanol, MW  90.12, 16.6 mmole +3 ml MeOH +3.63 g 1,3-dibrono-2-propanol&n..." current

8 June 2016

• 09:2309:23, 8 June 2016 diff hist +8,824 Taq purification No edit summary current

21 April 2016

• 01:0601:06, 21 April 2016 diff hist +1,006 Taq ligase 20160419 No edit summary current
• 01:0401:04, 21 April 2016 diff hist 0 N File:Small sm184 fam.jpg No edit summary current

24 March 2016

• 16:0216:02, 24 March 2016 diff hist +858 Ligation No edit summary current
• 15:5715:57, 24 March 2016 diff hist +9,997 Gene Synthesis by PCR No edit summary current

22 March 2016

• 10:0110:01, 22 March 2016 diff hist +1,562 Miniprep-Alkaline Lysis No edit summary current

21 March 2016

• 19:0519:05, 21 March 2016 diff hist +2,469 Synthesis of PHP-B1 No edit summary current
• 11:3611:36, 21 March 2016 diff hist 0 N File:03212016 transfection.JPG No edit summary current
• 11:3211:32, 21 March 2016 diff hist 0 N File:0321 Transfection.JPG No edit summary current
• 11:3111:31, 21 March 2016 diff hist 0 N File:IMG 0674 transfection.JPG No edit summary current

20 March 2016

• 13:5613:56, 20 March 2016 diff hist 0 N File:2016 3 20 compare.JPG No edit summary current

15 March 2016

• 16:4116:41, 15 March 2016 diff hist +115 Tat-Cre-Purification No edit summary current

4 March 2016

• 12:4212:42, 4 March 2016 diff hist +263 Employee List No edit summary current

3 February 2016

• 12:5412:54, 3 February 2016 diff hist +40 N Fase Eletrophoresis Buffer Paul.xu moved page Fase Eletrophoresis Buffer to Fast Eletrophoresis Buffer current

16 July 2015

• 18:3918:39, 16 July 2015 diff hist +40,982 RPA No edit summary current

6 July 2015

• 12:3112:31, 6 July 2015 diff hist +2,688 2461 2462 2467 Protein expression screening No edit summary current
• 12:3012:30, 6 July 2015 diff hist 0 N File:2461 2462 2467 copy.jpg No edit summary current
• 12:2512:25, 6 July 2015 diff hist 0 File:2461 2462 2467.jpg Paul.xu uploaded a new version of File:2461 2462 2467.jpg current
• 11:5811:58, 6 July 2015 diff hist 0 N File:2461 2462.jpg No edit summary current

24 June 2015

• 16:5516:55, 24 June 2015 diff hist 0 N File:Screening 2461 2462 2467.jpg No edit summary current

19 June 2015

• 17:0717:07, 19 June 2015 diff hist +1,712 N PCR Master Mix Created page with "10×PCR reaction buffer consisted of MgSO 4 20Mm, KCl 100 mM, (NH 4 ) 2 SO 4 80 mM, Tris-HCl (pH = 9.0) 100 mM and NP-40 0.5% (v/v). 5×compatible dye mix included 100g Ficoll..." current
• 16:2416:24, 19 June 2015 diff hist +3,764 N Red Taq Created page with "1) 0.01% Phenol red (R. J. Klebe, S. A. Rodriguez, M. L. VerBeek and T. A.<br/>Giambernardi, 1999. Simple method for "hot-start" RT-PCR. BioTechn.<br/>27(6):1108-1110.)<br/>2)..." current

18 June 2015

• 16:2816:28, 18 June 2015 diff hist +7,072 N PCR Testing of GM Food Created page with "PCR for Testing for GM Food Credits: Susie Stevens of Latta High School, Oklahoma; reported protocol derived from DNA Learning Center of Cold Spring Harbor Laboratory.<br/>Pa..." current

7 May 2015

• 18:4518:45, 7 May 2015 diff hist +15,426 N Yeast Fermentation Created page with "Cells for Pichia Expression GS115 P. pastoris cells from Invitrogen Recombinant ''P''. ''pastoris'' GS115 bearing the target gene in its genome was incubated in 100 ml of..." current