1045 pT7A3-T4-DNA-Kinase
Cloning of 1045 pT7A3-T4-DNA-Kinase
[edit]Purpose: Cloning of 1045 pT7A3-T4-DNA-Kinase
Date: December 26, 2012
Notebook:
Page:
Clone ID: 1045
Experimenters: Jennifer Truong
Results
[edit]Cloning
[edit]PCR using T4 phage genomic DNA
T4DNAKinase-Nde1-F cgatca catatg aaaaagattattttgactattg
T4DNAKinase-Xho1-R tagctgctcgagaaaatctcccgaagcgacttgcc
See lane 1 (~907 bp), ladder ran off the gel
Cut out gel, purify, save for tomorrow to digest
Date: Jan 4, 2013
PCR using T4 phage genomic DNA (1 uL of 1:10 dilution - unpurified) and the following primers
T4DNAKinase-Nde1-F cgatca catatg aaaaagattattttgactattg
T4DNAKinase-Xho1-R tagctgctcgagaaaatctcccgaagcgacttgcc
See lane 2 (~907 bp)
Cut out band, and purify
Digest insert (lane ) and vector (1514 pT7A3-MBP-(3C) lane ) with RE Nde1 and Xho1
Cut out bands, ligate together and transform
Colony Screening
[edit]Result intepretation/Summary
[edit]
Conclusion
[edit]