1274 pTXB1-RnaseH2
Jump to navigation
Jump to search
Cloning of 1274 pTXB1-RnaseH2
[edit]Purpose: Cloning of 1274 pTXB1-RnaseH2
Date: July 30, 2012
Notebook:
Page:
Clone ID: 1274
Experimenters: Jennifer Truong
Results
[edit]Cloning
[edit]Date: July 30, 2012
See lane 2
PCR using genomic DNA from Escherichia coli str. K-12 substr. MG1655
RnaseH2-Nde1-F AGCTCTCATatgatcgaatttgtttatccgcac
RnaseH2-Xho1-R gtctcgctcgagggacgcaagtcccagtgcgcgt
clone into Nde1 + Xho1 digested 1254 pTXB1-PT-ELK
Expected size 615 bp
Cut out band and save in box
Date: August 1, 2012
Digested insert (lane 2) with RE Nde1 + Xho1, vector is not good, digest again tomorrow, join with lane 2, purify and ligate together
Colony Screening
[edit]Date: August 6, 2012
Digested MiniPrep with RE Nde1 and Xho1, expected size 615 bp
Bad digestion gel, digest again tomorrow
Result intepretation/Summary
[edit]
Conclusion
[edit]