1275 pTXB1-RNaseT
Jump to navigation
Jump to search
Cloning of 1275 pTXB1-RNaseT
[edit]Purpose: Cloning of 1275 pTXB1-RNaseT
Date: July 30, 2012
Notebook:
Page:
Clone ID: 1275
Experimenters: Jennifer Truong
Results
[edit]Cloning
[edit]Date: July 30, 2012
See lane 3
PCR using genomic DNA from K-12 substr. MG1655
RnaseT-Nde1-F AGCTCTCATatgtccgataacgctcaacttac
RnaseT-Xho1-R gtctcgctcgagcacctcttcggcggcagatag
clone into Nde1 + Xho1 digested 1254 pTXB1-PT-ELK
Expected size 666 bp
Cut out band and save in box
Date: August 1, 2012
Digested insert (lane 3) with RE Nde1 + Xho1, vector is not good, digest again tomorrow, join with lane 3, purify and ligate together
Colony Screening
[edit]Date: August 6, 2012
Digested MiniPrep with RE Xho1 and Nde1, expected size 666 bp
Samples 1, 3, 4 5(?) may be correct
Send sample 3 to sequencing
Result intepretation/Summary
[edit]
Conclusion
[edit]