327 pLenti-Dest

Cloning of pLenti-Dest (327)

Purpose: to clone pLenti-Dest by PCR

Date: 2011-11-28 to 2011-12-

Notebook: Xiaojing Wang

Page: 004127---004131

Clone ID: 327

Experimenters: Xiaojing Wang

Results

The left bands show PCR product of 327,

Primer-F LV-GW-SpeI-F aactc ACTAGT ATCAACAAGTTTGTACAAAAAAG

Primer-R ad-GW-R Xho1 (TCTTGTACAAAGTGGTTGATtacccatacgatgttccagattacgcttgaCTCGAGatcga) tcgatCTCGAGtcaagcgtaatctggaacatcgtatgggtaATCAACCACTTTGTACAAGA

Digest result:

digest PCR product and vector with Spe I+Xho I,run gel

the left picture shows 327 insert, the middle picture shows 327 vector (pLentiPlus, 152) 

gel purify, ligate, transform ccdb survival,AMP

Colony Screening

Select 6 clones to mini-prep, digestd by Spe I and Xho I. 327-1,-2,-3,-6 may be correct. Control is 327-1.

pDonr221_EGFP(393) + pLenti-Dest(327-6) make gateway by LR Clonase II.

Transform 393+327-6 by STBL3, Amp.

Select 4 clones to mini-prep.

327+393-1,-2,-3,-4 plasmids transfect 293T cell line.

48 hours after transfection, take pictures.

327+393-1,-2,-3,-4 plasmids are digested by BamHI. 327+393-4 is control.

Band 1-4 is 327+393-1,-2,-3,-4 digested by BamHI.

327+393-1,-2,-3,-4 plasmids may be correct.