423-pET30b-DeepVent-sso7d

Cloning of pET30b-DeepVent-sso7d

Purpose: to clone pET30b-DeepVent-sso7dby PCR

Date: 2011-12-8

Notebook:Lu yingying

Page:

Clone ID:423

Experimenters: lu yingying
Results

DVent-Nde1-F

acgatc CATATG atgatacttgacgctgactac

DVent-BglII-R
(ggcttaacatcaagaagaag AGATCT atcaga)

tctgatAGATCTcttcttcttgatgttaagcc
NEB720 Deep Vent 385 as template
--Yingying.lu 13:03, 9 December 2011 (EST)

Cloning of pET30b-DeepVent-sso7d(423)
Purpose: to clone pET30b-DeepVent-sso7d
Date: 2012-5-3 to 2012-5-
Notebook: Xiaojing Wang
Page: 004238

Clone ID: 423
Experimenters: Xiaojing Wang

Results

NEB720 Deep Vent 385 as template

Fragment 1 PCR: DeepVent-Nde1-F1 + DeepVent-R1, 25 cycles
Fragment 2 PCR: DeepVent-F2 + DeepVent-BglII-R2, 25 cycles

join two fragments using Gibson Mix

digest with Nde1 + BglII, clone into Nde1 + BglII digested pET30b-sso7d-KX, 368

Ligate and transform DH5alpha, K+

5/6/2012

miniprep digest with Nde1 + BglII, marker is Fermentas 1 kb ladder

20000, 10000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 500, 400, 300, 200, 75

4 is not good, Nde1+ Xho1 cut should get 1 band (823 bp), Nde1+HindIII should get one band (1406 bp), bands are too big

digest with BglII-Xho1, HindIII-BglII. Looks like there are two Xho1 site, which is not expected

join two fragments using Gibson Mix, again 5/8/2012

digest with Nde1 + BglII, clone into Nde1 + BglII digested 423-9

Ligate and transform DH5alpha, K+