455 pGST

Cloning of pGST (455)

Purpose: to clone pGST by PCR

Date: 2011-10-25 to 2011-10-28

Notebook: Xiaojing Wang

Page: 004108---004109

Clone ID: 455

Experimenters: Xiaojing Wang

Results

The bands show PCR product of 455,

GST-Nde1-F agtca CATATGtcccctatactaggttattgg

GST-EcoR1-R EcoR1 ggtggtggcgaccatcctcca gaa ttc atcga oligo tcgatgaattctggaggatggtcgccaccacc

Digest result:

digest PCR product and vector with Nde1+EcoR1, run gel

the left bands show 455 insert, the right bands show pET30b vector

gel purify, ligate 2 hours, transform Top10,K+

Colony Screening