Blunt-end PCR Cloning
pMiniT
[edit]1. Assemble reaction mix
Linearized pMiniT Vector (25 ng/µl), 1 µl (25 ng)
PCR Insert* 4 µl*
Cloning Mix 1 (Buffer) 4 µl
Cloning Mix 2 (Ligase) 1 µl
Total Volume 10 µl
2. Incubate at room temperature (25°C) for 15 minutes.
3. Transform immediately (or store at –20°C)
4. Add 100 µl chemical competent cells, mix
5. Incubate on ice for 20 min.
6. Heat shock at 42°C for 30 seconds.
7. Chill on ice for 5 minutes.
8. Add 950 µl of SOC medium and place at 37°C for 60 minutes with rotation or shaking at 250 rpm
9. Spin down cells, 30 sec, max speed
10. Spread on LB/Amp plate
11. Incubate at 37 oC o/n
pJet 1.2
[edit]1. Assemble reaction mix
2X Reaction Buffer: 5 µL
PCR product: 4 µL (0.15 pmol)
pJET1.2/blunt Cloning Vector(50 ng/µL): 0.5 µL (0.025 pmol ends)
T4 DNA Ligase 0.5 µL
Total volume 10 µL 2. Incubate at room temperature (25°C) for 15 minutes.
3. Transform immediately (or store at –20°C)
4. Add 100 µl chemical competent cells, mix
5. Incubate on ice for 20 min.
6. Heat shock at 42°C for 30 seconds.
7. Chill on ice for 5 minutes.
8. Add 950 µl of SOC medium and place at 37°C for 60 minutes with rotation or shaking at 250 rpm
9. Spin down cells, 30 sec, max speed
10. Spread on LB/Amp plate
11. Incubate at 37 oC o/n
PCR Screening
[edit]Screening of clonies
[edit]1.Aliquot 5 ul of autoclaved H2O to 500 ul tubes.
2. Pick each individual colony, suspend in 5 ul H2O
3. Transfer 0.5~1 ul to PCR screening reaction mix
4. Add 500 ul LB/amp to the rest of E coli suspension, grow at 37 oC or at room temperature
Screening of culture
[edit]1.Aliquot 50 or 100 ul of LB/amp to 1.5 ml tubes.
2. Pick each individual colony, suspend in medium
3. Culture in an incubator at 37 oC for 1 hour
4. Transfer 0.5 ul culture to PCR screening reaction mix
pJet1.2
[edit]1. Assemble PCR reaction mix
Per reaction
10X Taq buffer 1.5 µL
10 uM dNTP mix 0.5 µL
pJET1.2 Forward Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-F2 catatccatccggcgtaatac
pJET1.2 Reverse Sequencing Primer, 10 µM 0.5 µL, or pJET1.2-seq-R2 cagcctgaaaatcttgagag
Water, nuclease-free 11 µL
Taq DNA Polymerase 5 u/µL, 0.5 µL
Total volume 15 µL
2. Aliquot 14 ul to each tube.
3. Add 0.5 ul bacterial suspension from colony or culture
4. PCR
95 oC 3 min
25~ 30 cycles of
95 oC 30 s
55 oC 30 s
72 oC 1 min per kb
72 oC 3 min
5. Add 5 ul 6X GRGreen Loading Dye
6. Run on 1% agarose gel
pMiniT
[edit]as pJet1.2, but use these two oligos
pMiniT-seq-R TCAGGGTTATTGTCTCATGAGCG
pMiniT-seq-F ACCTGCCAACCAAAGCGAGAAC
Restriction Enzyme Digestion
[edit]1. For PCR positive clones, transfer 10 ul culture to 5 ml LB/amp in 15 ml tube
2. Culture at 37 oC o/N in a shaker-incubator.
3. Spin down cells,
4, Add 250 ul P1, suspend cells by votexing for 1~2 min.
5. Add 250 ul P2. Mix gentely, let lysis for 1 min
6. Add 350 ul N3. Mix
7. Transfer to 1.5 ml tube.
8, Spin 2 X 3 min.
9. Transfer supernatant to a miniprep column (column from China must be pretreated: soaked in 5 N NaOH for 30min, spin to remove NaOH from column)
10. Spin for 3 sec
11. Add 350 ul PB, spin, remove liquid
12. Add 700 ul PE, spin, remove liquid
13. Spin for 1 min at max speed
14. Add 50 ul EB or TE buffer, soak for 3 sec,
15. Spin for 1 min at max speed
16. Check DNA quality and quantitate DNA concentration using nanodrop
Digestion
Use 5 ul miniprep for digestion
1. make mix, per reaction
1.5 ul FastDigestion Buffer
0.3 ul enzyme 1
0.3 ul enzyme 2 (if required)
5 ul miniprep
H2O to 15 ul
2. Incubate at 37 oC for 30 min in an incubator
3. Add 5 ul 6X GRGreen loading buffer
4. Run on 1% agarose gel
5. Take a picture using blue light transilluminator
6. Process gel picture and upload to ELN
7. Document all experimental details