Enrichment of Antigen-binding B Cells using Magnetic Beads

Antigen-specific B-cell enrichment and phenotyping

BALB/c mice were immunized with 50 μg of pMHCII emulsified in complete Freund's adjuvant (CFA, Sigma) subcutaneously in the base of the tail. Seven days post immunization single-cell suspensions from spleen and pooled lymph nodes (inguinal, brachial, cervical and axillary) were prepared by forcing the tissue through a 100 μm cell strainer using the plunger end of a 1 ml syringe, washed with RPMI containing 2% FBS and resuspended in 100 μl Fc block (2.4G2, 0.05% sodium azide). The cells were next incubated with 5 nM SA-PE-AF647, and SA-APC-DyLight755 for 10 min at 25 °C, followed by peptide:MHCII-conjugated PE and APC tetramers at 10 nM for 25 min on ice in a final staining volume of 200 μl. The cells were then washed with 12 ml PBS+2% FBS, resuspended in 150 μl of PBS+2% FBS, mixed with 25 μl anti-PE and anti-APC MicroBeads (Miltenyi Biotec) and incubated for 25 min at 4 °C. The cells were then washed with 12 ml PBS+2% FBS, resuspended in 3 ml PBS+2% FBS and applied to a magnetized LS column (Miltenyi Biotec). The column was washed three times with 3 ml PBS+2% FBS, removed from the magnet and the cells were eluted in 5 ml PBS+2% FBS. All the eluted cells and 1/20th of the flowthrough were then centrifuged and stained with surface antibodies IgM-BV421 (RMM-1, BioLegend), B220-PE-Cy7 (RA3-6B2, Tonbo Biosciences), CD38-AF700 (90, eBioscience), GL7-FITC (GL7, eBioscience), IgD-BV786 (11-26 c.2a, BD Biosciences), CD11b-BV510 (M1/70, BD Biosciences), CD11c-BV510 (N418, BioLegend), F4/80-BV510 (BM8, BioLegend), CD90.2-BV510 (53-2.1, BioLegend), Live/Dead Ghost 510 dye (Tonbo Biosciences) for 30 min at 4 °C. Next, the cells were fixed with Cytofix/Cytoperm solution (BD Biosciences) for 20 min at 4 °C, washed twice with permeabilization buffer and stained with intracellular antibodies IgG (H+L)-AF350 (polyclonal, ThermoFisher Scientific) for 30 min at 4 °C in permabilization buffer before the flow cytometry analysis on a LSRII Fortessa instrument (Becton Dickinson) equipped with five laser lines (355, 405, 488, 561 and 640 nm). All antibodies were used at a 1:100 dilution for staining, except CD90.2, which was diluted 1:500. The data were analyzed using FlowJo software (v.10).

Isolation and fusion of antibody-producing B cells BALB/c mice were immunized subcutaneously in the base of the tail with 50 μg of p:MHCII monomer emulsified in complete Freunds' adjuvant. Twenty eight days later each mouse was boosted by intravenous (i.v.) injection of 100 μl total volume containing 25 μg of p:MHCII in PBS. Three days after boost a single cell suspension was made from pooled spleens and draining lymph nodes. Cells were stained in 150 μl of complete media (DMEM, 10% FCS, β-ME, pen/strep, nonessential amino acids) containing 13.3 nM PE-conjugated p:MHCII/mouse and incubated on ice for 25 min. Cells were washed with complete media and resuspended in 200 μl of complete media containing 50 μl of anti-PE microbeads (Miltenyi Biotec)/mouse and incubated on ice for 25 min. Cells were washed with complete media and resuspended in 5 ml of complete media/spleen. The cell suspension was then applied to a pre-equilibrated LS magnetic column (Miltenyi Biotec) and washed 2 × with 3 ml of complete media. The cells were eluted from the column in 5 ml medium A (Stem Cell Technologies), centrifuged and enumerated. The enriched B cells were fused with SP2/0 mouse myeloma cells using the HY Hybridoma Cloning Kit according the manufacturer's protocol using method A (Stem Cell Technologies). A small portion of the enriched cells and flowthrough was stained as described above to determine antigen-specific B-cell purity and phenotype before hybridoma fusion.

Hybridoma selection and specificity screening Twelve days post-HAT selection, individual colonies were handpicked and transferred to 96-well plates containing medium E (Stem cell technologies). Four days later hybridoma supernatants were transferred to 96-well plates and fresh medium E was added to the cells. To test the specificity of hybridoma supernatants for MHCII and p:MHCII, a decoy screening approach was employed. ELISA plates were coated with 50 ng well−1 either p63:IAg7 or InsB10–23:IAg7 (for p63:IAg7 antibodies), or 2W:IAb or LLO:IAb, and then blocked with 1% BSA in PBS for 1 h. Hybridoma supernatants were mixed 1:1 with ELISA wash buffer (PBS+0.05% Tween20) and added to the p:MHCII-coated plates and incubated at 37 °C for 2 h. Media alone was used as a negative control while anti-IAg7 (clone 10–2.16 (ref. 28), BioXcell) or anti-IAb (Y3P29, ATCC) were used as a positive control. For antibody detection the wells were incubated with HRP-conjugated goat anti-mouse IgG (BioLegend) diluted to 1:2,000 at room temperature for 2 h followed by addition of ABTS substrate solution (KPL) and detection by absorbance at 405 nm. Antibodies reacting to both p:MHCII monomers were considered specific for MHCII independent of peptide, while antibodies reacting with only p63:IAg7 or 2W:IAb were considered p:MHCII specific.

Antibody affinity measurements and sequencing The affinity of the two novel MAb generated (FS1 and W6) were directly compared with known IAg7 or IAb specific antibodies (10–2.16 (ref. 28) (BioXcell), Y3P29 (ATCC), Y-Ae3 (eBioscience) and AF6-120.1 (ref. 30) (BioLegend)) by Bio-Layer Interferometry by Precision Antibody (Columbia, MD). Antibody sequences were obtained using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer's instructions. Primers used for reverse transcription were GATTACGCCAAGCTTTATGCAAGGCTTACAACCACA (heavy chain), GATTACGCCAAGCTTCACAATTTTCTTGTCCACCTTGGTGC (heavy chain nested), GATTACGCCAAGCTTCTCATTCCTGTTGAAGCTCTTGACAAT (kappa light chain), GATTACGCCAAGCTTACACTCAGCACGGGACAAACTCTTCTC (lambda light chain 1, 4), GATTACGCCAAGCTTACACTCTGCAGGAGACAGACTCTTTTC (lambda 2,3).