Hapten Antibody Generation in Llama

Pierce: Blue carrier immunogenic proteinTM (BIP)

Sigma: Methotrexate (MTX), N-(3-dimethylaminopropyl)-N'-ethylcarbo-diimide (EDC)

Conjugation The immunogenic form of MTX was synthesized by coupling MTX (0.16 M) to BIP (20 mg/ml) using EDC (0.26 M) in N-(2- hydroxyethyl)-piperazine-N'-2-ethanesulfonic acid (HEPES) buffer pH 8.0 (Becker et al., 1998). The conjugate was purified by gel filtration on a Sephadex G-25 column (PD 10, GE Healthcare, Uppsala, Sweden) and used for immunizations. MTX was also coupled to BSA and the conjugate was used as antigen in antibody selection and immunoassays. The extent of MTX coupling per mole of carrier protein was determined spectrophotometrically with the absorption of the hapten-protein conjugate at 365, 495 and 280 nm compared with that of protein and MTX.

Immunization One female llama was immunized by a single intramuscular injection of MTX–BIP conjugate (2.5 ml, 1 mg) mixed with an equal volume of Freund’s incomplete adjuvant followed by three booster injections every 2 weeks. The blood of immunized animal was collected, treated by centrifugation and the sera were stored in aliquots at−20 ◦C. Peripheral blood lymphocytes were obtained by centrifugation on a Ficoll cushion (Eurobio, les Ulis, France) and stored at −70 ◦C until further use.

ELISA The immune response was monitored by titration of sera by an enzyme-linked immunosorbent assay (ELISA) with MTX–BIP, MTX–BSA and blue carrier protein immobilized on NuncImmunoTM 96 MicrowellTM MaxisorpTM plates (Nunc A/S, Roskilde, Denmark) (the coating solution contained 1µg of protein per ml diluted in phosphate buffered saline PBS (100 µl/well)). Wells were blocked with 1% BSA–PBS (200µl/well) and incubated with serum dilutions in 0.1% BSA–PBS. After extensive washings, the bound llama antibodies were detected with a goat anti-human gamma chain antibody conjugated to horseradish peroxidase (HRP) (Clinisciences, Montrouge, France). Peroxidase enzyme activity was determined by adding 1 mg/ml ABTS as substrate and read out at 405 nm.

Cloning

Sets of primers were prepared in order to amplify the VH domains (V–D–J-REGION), including the VHH domains from non-conventional IgG2 and IgG3. Three V sense primers (VH1.1, VH1.2, VH1.4) correspond to the FR1- IMGT codons 1–8 of the V-REGION and contain a BglI site GCCNNNN'NGGC (underlined) for cloning. The antisense primer CH2-2 used for preparing first-strand cDNA corresponds to codons 39–45 according to the IMGT unique numbering for C-DOMAIN (Lefranc et al., 2005c) of the CH2 (codons 45–51 in the exon numbering). The antisense primer JH used for the amplification of the PCR product of∼400 base-pair (bp) (see below) corresponds to the 3'- end of the IGHJ regions (AF305952) codons 8–15 of IGHJ4, for example, and codons 121–128 in rearranged genes, according to the IMGT unique numbering for V-DOMAIN (Lefranc et al., 2003) and contains a NotI site GC'GGCCGC (underlined) for cloning.

Primer	DNA sequence
VH1.1	5-CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCA GGTGCAGCTGGTGCAGTCTGG-3'
VH1.2	5'-CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGG TCACCTTGAAGGAGTCTGG-3'
VH1.4	5'- CATGCCATGACTGCCGGCCCAGCCGGCCATGGCCCAGG TGCAGCTGCAGGAGTCGGG-3'
CH2-2	3'-CGCCATCAAGGTACCAGTTGA-5'
JH	3'-CCACGATTCTGCGGCCGCTGAGGAGAC(AG)GTGACCT GGGTCC-5'

RNA isolation and PCR amplification Lymphocytes from 60th day of immunization was used for library construction. Total RNA was isolated from about 107 lymphocytes using the RNAble® kit (Laboratoire Eurobio, Courtaboeuf, France). The concentration of mRNA was calculated from the absorbance at 260 nm using a Gen Quant II spectrophotometer (GE Healthcare). About 2.5 µg of mRNA was used for preparing first-strand cDNA with 1 pmol of CH2- 2 specific primer. PCR was performed on the cDNA using the three V sense (VH1.1, VH1.2, VH1.4) primers and the antisense CH2-2 primer, to amplify the DNA fragments (VH-CH1-hingepart of CH2) from conventional IgG1 and (VHH-hinge-part of CH2) from non-conventional IgG2 and IgG3. In this primary PCR, 2µl of cDNA was mixed with 2 pmol of each of the four primers. For Taq Deep VentR ® (New England Biolabs, Ipswich, MA, USA), 10 µ l of 10× reaction buffer, 2µl of 100mMMgSO4, 2 µ l of 10mMdNTP and water were added to a final volume of 98 µl. The PCR protocol consisted of an initial denaturation step at 94 ◦C for 3 min followed by 37 cycles of 94 ◦C for 1 min, 50 ◦C for 1 min, 72 ◦C for 1 min and a final extension step at 72 ◦C for 10 min. Amplified products were size selected on a 1.2% agarose gel and consisted in two bands, the upper one of ∼850 bp that corresponds to DNA fragments (VH-CH1-hinge-part of CH2) from conventional IgG1 and the lower one of ∼600 bp (570–650 bp) to DNA fragments (VHHhinge- part of CH2) from the non-conventional IgG2 and IgG3. The lower band was purified by using a QIAquick Gel extraction kit (Qiagen GmbH, Hilden, Germany) and the DNA was reamplified using the three sense V primers (VH1.1, VH1.2, VH1.4) and the antisense JH primer (which anneal at FR4- IMGT positions 121–128 in rearranged genes). These primers have the respective BglI and NotI cloning sites for subsequent cloning into the phagemid vector. In the PCR protocol, 1 µl of cDNA was mixed with 2 pmol of the each primer, VH1.1, VH1.2, VH1.4 and JH. For Taq Promega, 5µl of 10× reaction buffer, 3µl of 25mM MgSO4, 1µl of 10mM dNTP and water were added to a final volume of 49µl. The PCR protocol consisted of an initial denaturation step at 94 ◦C for 2 min followed by 37 cycles of 94 ◦C for 40 s, 55 ◦C for 1 min, 72 ◦C for 1 min and a final extension step at 72 ◦C for 10 min. PCR products (∼400 bp) that correspond toVHHfragments (V–D–J REGION of non-conventional IgG2 and IgG3) were size selected on a 1.2% agarose gel and purified prior to endonuclease digestion.

2.6. Library construction VHH libraries were constructed in the pHEN1–6×HisGS vector (constructed by D. Baty) using DNA from the 60th day immunization. Briefly, prior to cloning VHH-encoding DNA, phagemid was prepared by restriction endonuclease digestion with SfiI and NotI (New England Biolabs) and VHH fragments were digested with BglI and NotI. The vector (13 µg) was mixed with 3U/µg DNASfiI (20 U/µl) and 10µl of 10× NEB3 buffer to a final volume of 100µl and incubated overnight at 50 ◦C. VHH fragments (5µg) were digested with 3U/µg DNA BglI (10 U/µl) and 5µl of 10×NEB3 buffer to a final volume of 50µl and incubated overnight at 37 ◦C. Then 3 and 2U/µg NotI were added to each PCR product and vector, respectively, in the same reaction buffer. After incubation at 37 ◦C overnight, digests were purified on a 1.2% agarose gel as described above. For control purposes, the target relevant fragment excised from the vector was also purified. For phage display library construction, 2 µg of digested vector and 400 ng of VHH fragments were ligated in 2µl 10× ligase buffer, 1µl of T4 ligase (2000 U/µl) and water to a final volume of 20 µl. The ligation mixture was incubated overnight at 16 ◦C. Background ligation was also determined by self-ligation of the vector (100 ng), 100 ng of stuffer fragment excised from the vector were used as a negative control and 100 pg of circular vector as a positive control. The product (pHEN1–6×HisGS vector containing VHH genes) was electroporated into competent TG1 Escherichia coli cells (Griffiths et al., 1994).

Selection of phage-displayed VHH library Library size was calculated by plating aliquots on 2×TY ampicillin agar. Thirty clones were used for plasmid DNA preparation (QIAprep Spin Miniprep kit, Qiagen) and sequenced for diversity analysis. Transformants were grown in 2×TY medium with 100µgml−1 ampicillin for 3 h at 37 ◦C (OD600 = 0.5–0.6), and infected with 20-fold excess of M13K07 helper phage (GE Healthcare) for 1 h at 37 ◦C. Infected cells were harvested by centrifugation, resuspended in 500 ml of 2×TY with 100µgml−1 ampicillin and 50 µgml−1 kanamycin and incubated overnight at 30 ◦C with agitation. Phage particles were precipitated from culture supernatant with 4% PEG 6000, 0.5M NaCl, resuspended in sterile PBS and used for panning. For panning, 1011 phage particles in 2% PBS-skimmed milk were incubated for 2 h in Nunc-ImmunoTM MaxisorpTM tubes (Nunc A/S) with immobilized MTX–BSA and BSA as negative control. After 20 washes with 0.1% Tween 20-PBS, the phage particles complexed to MTX via their exposed VHHs were eluted with 0.1M triethylamine, pH 11.0. Eluted phages were titrated and subjected to two other rounds of panning following the same procedure. Phage titers of input and output at all steps were estimated by infection of TG1 cells and plating on 2×TY ampicillin plates.

Phage binding analysis The specificity and reactivity of the VHH-phages toward MTX at the third round of panning were determined by ELISA. For this assay, colonies were grown in ELISA microplates in 2×TY with 100µgml−1 ampicillin and 2% glucose for 3 h at 37 ◦C under agitation and infected with 20-fold phage particles of M13K07 helper phage for 30 min. Cells were pelleted, resuspended in 2×TY with 100µgml−1 ampicillin and 50µgml−1 kanamycin, and incubated overnight at 30 ◦C. Culture supernatants were diluted two-fold in PBS-skimmed milk 5% and added to ELISA microplates coated with 10µgml−1 MTX–BSA or control BSA. After 1 h at 37 ◦C and washing

with 0.05% Tween-PBS, bound phages were detected with 1/500 anti-M13 mouse monoclonal antibody conjugated to HRP (GE Healthcare). After 1 h at room temperature, the read out of reactivity was obtained at 405 nm by addition of ABTS using an automated microtiter plate reader (Thermo Electron Corporation, San Jose, USA).

Screening of soluble VHH domains The cDNA of ELISA-positive individual phages from the third round of panning were used to infect a non-suppressor E. coli strain (C41). Clones were inoculated to 5ml 2×TY supplemented with 100 µgml−1 ampicillin and 2% glucose. The culture was grown in a shaker incubator and induced with 1mM IPTG at OD600 = 0.5–0.6 for the night at 30 ◦C. Cells and supernatants were separated by centrifugation and dissolved in Trisbuffer containing 5% mercaptoethanol, glycerol and 10% SDS and loaded on 15% SDS polyacrylamide gels, electrophoresed and transferred to PVDF membranes. The membrane was saturated by incubation in 3% BSA with PBS for 1 h then probed by incubation with an anti-c-myc mouse monoclonal IgG1 antibody 9E10 (Sigma–Aldrich) overnight at 4 ◦C. Bacterially expressed VHH domains were then detected using anti-mouse IgG conjugated to HRP as secondary antibody as previously reported. 2.11. Large-scale production of VHH domain Positive clones were selected for large-scale production and purification of VHH domains. For this purpose, 10 ml of an overnight culture from a single colony were used to seed 500 ml culture in 2×TYmedium supplemented with 100µgml−1 ampicillin. This culture was grown at 30 ◦C for 1.5 h, then diluted two-fold in the same medium and incubated until obtaining an optical density of 0.5–0.6 at 600 nm. The VHH expression was induced with 1mM IPTG following overnight incubation at 30 ◦C. After pelleting the cells, the periplasmic proteins were extracted by osmotic shock (Lorimer et al., 1996). 6×His-tagged VHH from periplasmic fractions were purified by fast protein liquid chromatography (FPLC) using a HisTrap HP metal affinity resin column (GE Healthcare). VHH proteins were eluted with 250mMimidazole (Sigma–Aldrich) and subsequently dialysed against PBS.

Surface plasmon resonance of soluble VHH binding

VHH affinities for MTX immobilized on carrier protein were determined on a Biacore 2000 apparatus (Biacore AB, Uppsala, Sweden). MTX–BSA was covalently immobilized on a flow cell of a carboxymethyl dextran sensorchip (CM5 Biacore AB) using the amine coupling method according to the manufacturer’s instructions. The immobilization level was 500 resonance units (RU). A second flow cell was treated with the same chemical procedure without MTX and used as a reference. At a constant flow rate of 50 µl/min and a temperature of 25 ◦C, different concentrations of VHH ranging from 66 to 2128nM in Hepes-buffered saline (0.01MHEPES, pH 7.4, 0.15MNaCl, 3mMEDTA, 0.005% surfactant P20) were injected during 180 s over the two flow cells and followed by a dissociation step of 400 s. Between each run, sensor surfaces were regenerated with a pulse of 20mM NaOH. All sensorgrams were fitted by subtracting the signal from the reference flowcell and were globally treated using BIAevaluation version 3.2 software (Biacore AB). Experiments at different flow rates showed an absence of mass transport and rebinding effect. All experiments were repeated twice and no binding of VHH was observed on a BSA immobilized flow cell. To check the affinity against free MTX,VHH3.4 was immobilized at 916 RU on a CM5 sensorchip. Different concentrations of MTX (250–4000 nM) were injected. The resulting sensorgrams were fitted by a global Langmuir 1:1 model.

MTX binding of VHH domains evaluated by ELISA

MTX–BSA (10µg/ml) was coated onto the wells of microtiter plates at 4 ◦C overnight. BSA was used at the same concentration as a negative control. Wells were blocked with PBS-skimmed milk 4% (200 µl/well) and incubated with serum dilutions in 2% skimmed milk-PBS. After three washes, the boundVHHwere detected with the monoclonal anti-c-myc antibody 9E10 conjugated to horseradish peroxidase (Cambridge Bioscience, Cambridge, UK). Peroxidase enzyme activity was determined after adding ABTS as substrate and measuring at 405 nm. Competition ELISA was performed to assess binding of antibodies to soluble hapten. VHH domains (3 µM) were incubated with serial dilutions of soluble MTX (1.6–100 µM). To determine specificity of VHH, competition tests were also performed with serial dilutions of two structurally related analogs of MTX (folic acid and folinic acid) (Cot et al., 1987). The antibody-competitor mix was then transferred to microtiter wells coated with 0.15nM of MTX–BSA and incubated for 90 min. Unbound VHH domains were washed with 0.05% Tween-PBS and bound VHH domains were detected as described above.