Helicase-dependent amplification HDA

Asymmetric helicase-dependent amplification (HDA) Amplification reactions were set up according to conditions as provided by the IsoAmp II Universal tHDA Kit
(BioHelix, Beverly, MA). For each individual HDA reaction, 5 uL of nasal mucus lysate was first mixed with 15 μL of Dilution Buffer, giving rise to concentrations of 20 mM Tris–HCl, pH 8.8, 10 mM KCl, 7.7 mM MgSO4, 40 mM NaCl, 5 mg/mL BSA, and 0.02% Tween 20. This was then added to 20 uL 2x HDA-Mix {20 mM Tris–HCl, pH 8.8, 40 mM NaCl, 0.02% Triton X-100, 0.4xEvaGreen (Biotium, Hayward, CA), 6.8 mM dATP, 0.8 mM dCTP, 0.8 mM dGTP, 0.8 mM dTTP, 10 ng/uL
uvrD Thermostable DNA Helicase, 1.6 U/uL GST Polymerase Large Fragment, 4 ng/uL ET SSB (Extreme Thermostable Single-Stranded DNA Binding Protein), and diluted RNase H2 (Great Basin Corp), 600 nM Forward primer, and 800 nM biotinylated Reverse primer (5’ Biotin-TEG)} and mixed thoroughly in a well of a LightCycler 480 Multiwell Plate 96 (Roche Diagnostics, Indianapolis, IN). The multiwell plate was transferred into a LightCycler 480 instrument and incubated for 60 minutes using an isothermal temperature profile set to 65°C. Primers were ordered from IDT, and each primer contained a single ribo-nucleotide close to the 3’ end as well as a 3’ blocking group, creating “hot start-like” conditions. Deblocking requires that primers be annealed to the target DNA sequence, resulting in cleavage by RNase H2 at temperatures above 50°C, followed by polymerase extension. Primer artifact is suppressed because the RNase H2 is inactive at low temperature. The nucleotide sequences of the amplification primers were 5’ –TGGTAGAAAATGCAAAGAAAATTGAAGTC[rG]AGTT-3’ for the Forward primer and 5’- TCCATCAGCATAAATATACGCTAAGCCA[rC]GTCC-3’ for the Reverse primer, giving
rise to an amplification product size of 95 base pairs.