Hot Start Taq DNA Polymerase

Cold-sensitive mutants of Taq DNA polymerase provide a hot start for PCR

Milko B. Kermekchiev1,2*, Anatoly Tzekov1,2 and Wayne M. Barnes1,2 *

Primers used for mutagenesis.
KT85 = GCA GTA CCG GGA GCT CAC CAA GCT GAA GA 
KT32 = GCG AAG CTT ACT ACT CCT TGG CGG AGA GCC AGT CC

Purification of Large Amounts of Klentaq-278, as described in U.S. Patent 5.436.149.

Lysis:

Resuspend the cells in milliliters of TMN buffer equal to twice the packed cell weight in grams:  (50 mM Tris-HCl pH 8.55, 10 mM MgCl2, 16 mM (NH4SO4).

Scale quantities to 150 g. of cells, if scalar quantities are not given.

To each 300 ml of cell suspension add 60 mg lysozyme and incubate the cells at 5-10° C. with occasional swirling for 15 minutes.  Then add IGEPAL or Triton X100 to 0.1%, and Tween 20 to 0.1%, by adding 1/100 volume of a solution of 10% in each.

Freeze at -80° C. at this point, for storage of cells.

Later, thaw with the aid of cold tap water.

Then heat the cell suspension rapidly to 80° C. by swirling it in a boiling water bath, then maintain the cells (fast becoming an extract) at 80-85° C. for 20 minutes.  Use a clean thermometer in the cells to measure temperature.  Be sure the flask and bath are covered (with foil), so that even the lip of the flask gets the full heat treatment.  After this treatment, which is expected to have inactivated all but a handful of enzymes, cool the extract to 37° C. or lower in an ice bath and add 2 ml of protease inhibitor (100 mM PMSF in isopropanol).  From this point forward, try not to contact the preparation with any flask, stir bar, or other object or solution that has not been autoclaved (or, if the material can stand it, baked in an oven on the self-cleaning cycle.  Detergents and BME are not autoclavable.  We don't autoclave the PEI or the ammonium sulfate, either, but perhaps we should.)  The purpose of this is not only to avoid microbial contamination, but also to avoid contamination with DNA or nucleases.

Distribute into centrifuge bottles and centrifuge at 2° C.   (for instance, 30 minutes at 15 krpm in a Sorval SS 34 rotor or overnight 14 h at 4 krpm in a GS3 rotor).  The supernatant is designated fraction I, and can be assayed for DNA polymerase activity.

High-salt PEI precipitation

After rendering fraction I to the conductivity equivalent to 0.125 M in NaCl (too much NaCl may result in nuclease contamination in the final enzyme; compare and match conductivity to KTA0 + 0.125 M NaCl; probably, don�t add any NaCl; perhaps, add KTA0 to get the conductivity down), add five percent Polymin-P (PEI, polyethylene-imine, Sigma) dropwise with stirring on ice to precipitate nucleic acids.  To determine that adequate Polymin-P has been added, test 1/2 ml of centrifuged extract periodically by adding a drop of Polymin-P, and if more precipitate forms, add more Polymin-P to the bulk extract.  Put the test aliquots of extract back into the bulk without contaminating it.

To confirm that enough PEI has been added, centrifuge 3 ml and aliquot the supernatant into 1/2 ml aliquots.  Add 0, 2, 4, 6 or 10 ul of 5% PEI.  Shake, let sit on ice, and centrifuge in the cold.  Load 15 ul of these aliquot supernatants onto an agarose gel containing ethidium bromide and electrophorese until the blue dye has travelled 2 cm.  Inspect the gel on a UV light box for detectable DNA or RNA in the supernatant.  For the bulk extract, use about 1/100 volume (i.e. 2 3 ml for a 300 ml extract)excess PEI over the minimum necessary to remove all DNA by the agarose gel test.  Stir in the cold for at least 15 minutes.  Centrifugation of the extract then removes most of the nucleic acids.  Keep the supernatant, avoiding any trace of the pellet.

Save PEI pellets until final enzyme recovery is confirmed.

We may have recently noticed a correlation between larger excesses of PEI and lower contaminating DNA in the final product.  According to this, one should not be so careful to add a minimum amount of PEI; but we don't know what the maximum safe level is.

REPEAT THE PEI STEP

After the full-size centrifugation, pour off the supernate to clean baked flasks, and test ½ ml aliquot with a drop of 5% PEI.  If more precipitate forms, which often (usually) happens, even though we thought we had added enough the first time, then repeat the whole PEI process, trying to add somewhat more than enough.  Even if more precipitate does not form, add a little more PEI (1/100 volume of 5%).  Let this second PEI precipitation sit in the refrigerator overnight before centrifuging.

After centrifuging, filter the supernatatant through large Kimwipe, in a baked glass funnel, into baked glass flasks.  This is to avoid any little specks of PEI-DNA pellet.

Different detergent:  After this point detergent Thesit (Sigma or Boehringer-Mannheim) must be present at 0.1% to 0.5% (usually 0.1%) at all times and in all buffers and solutions.   Add some to the final PEI supernatant now.

Bio-Rex 70 Flow-Through (room temp., but catch flow-through in container on ice).

Chromatography with Bio-Rex 70 (used by Joyce & Grindley) is unsuccessful (no binding), but unavoidable, since without it, the next column (heparin agarose) will not work efficiently.  Therefore the purpose of the Bio-Rex 70 is to remove the PEI.  CM-cellulose does not substitute for Bio-Rex 70.  In fact, since CM-cellulose doesn't bind the enzyme, we use some of it as a column bed under the Bio-Rex 70 and the heparin agarose columns.

Dilute the entire enzyme fraction with KTA0 + .1% Thesit until it has no more ionic strength than KTA + 22 mM ammonium sulfate (A.S.).  (Check conductivity of 1/40 dilution compared to similar dilution of genuine 22 mM in KTA.)  Pass it through equilibrated Bio-Rex 70 (at least 10 ml per 100 g. cells).  The polymerase activity flows through.  Rinse the column with 2 column volumes of 22 mM A.S. / KTA.

-->  It may be better, and it is easier and faster, to set up these two columns in series, so that the Bio-Rex flow-through flows immediately onto the heparin agarose.

Heparin Agarose Chromatography (room temp., but put fractions on ice as they come off.)

Load the Bio-Rex flow-through slowly onto heparin agarose that has been equilibrated with KTA+0 buffer.  (Sigma; 10-50 ml per 100 grams of cells).  Wash with several column volumes of KTA + 22 mM A.S., then two to three column volumes of KTA in 63% glycerol + 22 mM A.S., then elute the pure enzyme with KTA that has 63% (w/v) glycerol and 222 mM A.S. + 0.5% Thesit.

Pool the peak of polymerase activity, or OD280 > 1.  Read the OD280 of the pool.  Thesit is used as the detergent because it has no OD280.

PCR templates, primers and cycling conditions for amplifications improvable by a hot start. 
Human genomic DNA was purchased from Novagen, and Cryptosporidium DNA  was kindly provided from Kansas State University (Cryptosporidium Research Program). HIV gag gene control target was provided from Applied Biosystems.

A typical 50 ul PCR reaction contained 1xKLA PCR buffer (50 mM tris-HCl, pH 9.2, 16 mM ammonium sulphate, 2.5 mM magnesium chloride, 0.1% Tween-20) with addition of magnesium chloride and each dNTP (Pharmacia) to final concentration 3.5 mM and 250 uM, respectively, and 0.05-0.1 ul (40-80 ng) of DNA polymerase.

The following primers (10 pmoles each, purchased from Integrated DNA Technologies), DNA templates and cycling conditions were used:

Human HIV co- receptor (CCR5) gene primers: 
CCRD5: AGGTACCTGGCTGTCGTCCATGCTGTGTTT; 
CCRD3: GATGATGGGGTTGATGCAGCAGTGCGTCAT; 
Template: 50 ng human genomic DNA (Novagen). 
1 cycle 68/10 min; 35 cycles: 95 deg/50 sec; 67 deg/30 sec; 68 deg/3 min. 
Reactions contained 1.3 M betaine (Sigma).

HIV gag gene primers: 
SK38: ATAATCCACCTATCCCAGTAGGAGAAAT; 
SK39: TTTGGTCCTTGTCTTATGTCCAGAATGC; 
Template: 25 copies HIV (HIV DNA, Applied Biosystems), complemented with 100 ng denatured human DNA (Novagen) 
1 cycle 94 deg/2 min; 42 cycles: 94 deg/50 sec; 53 deg/1 min; 68 deg/1 min.

Human dystrophin gene, exon 21: 
DMDex21F: CGCTGTGATAGAGGCTTGTCTATA; 
DMDex21R2: CTGGCCTGCACATCAGAAAAGACT; 
Template: 50 pg denatured human DNA (Novagen). 
1 cycle: 94 deg/2 min; 40-42 cycles: 94 deg/50 sec; 59 deg/50 sec; 68 deg/2 min.

Human dystrophin gene, Alu7-2 repeat: 
DMDalu7-2F: CAAATTGTCTAGGCTGGTCTTGAA; 
DMDex7R: GTCGTTGTGTGGCTGACTGCTGGCA; 
Template: same as above; 
1 cycle: 94 deg/2 min; 42 cycles: 94 deg/50 sec; 65 deg/1 min; 68 deg/2 min.

Cryptosporidium heat shock protein homolog gene: 
CPHSPT2F: TCCTCTGCCGTACAGGATCTCTTA; 
CTHSPT2R: TGCTGCTCTTACCAGTACTCTTATCA. 
Template: 0.1 pg Cryptosporidium DNA 
1 cycle: 94 deg/2 min; 42 cycles: 94 deg/50 sec; 58 deg/50 sec; 68 deg/2 min.

The four rDNA targets in Figure 5 are amplified with the following 
combinations of primers:

1: 1UP + 2D 
2: B-UP + M-D 
3: B-UP + 3D 
4: 28-UP + M-D 
 

1 UP: tgctaggcgccggccgaggcga 
2D: cgaaagggagtcgggttcagatct 
B-UP: cactgggcagaaatcacatcgagtcaacacc 
M-D: cccgcgtgccacctctcttccc 
3D: tgagagatgggcgagtgccgttccgaag 
28-UP: tactcctctcatgtctcttcaccgtgcct

75-100 ng mouse  DNA (Novagen) were amplified in 50 ul reaction volume with  0.1-0.2 ul KT1-Cs3AC-LA enzyme mixture [formulated by volume, 47:1::KT1-Cs3AC:Deep Vent]  in KLA buffer containing 1.6 M betaine. 
2.5 U  FastStart Taq or Platinum Taq were applied using the respective buffer and Mg concentration recommended by the manifacturers. 
Cycling conditions: 1x 94 deg/4 min, followed by 40 cycles: 94 deg/40 sec, 66 deg/40 sec, 68 deg/5 min.